ID: 1049653749

View in Genome Browser
Species Human (GRCh38)
Location 8:143788776-143788798
Sequence CAGTGCTCACAGCTGGTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049653749_1049653752 -3 Left 1049653749 8:143788776-143788798 CCACGCACCAGCTGTGAGCACTG No data
Right 1049653752 8:143788796-143788818 CTGAGGCCCTTTCTGCATAATGG No data
1049653749_1049653755 16 Left 1049653749 8:143788776-143788798 CCACGCACCAGCTGTGAGCACTG No data
Right 1049653755 8:143788815-143788837 ATGGCACCCTTTCTCCCAGATGG No data
1049653749_1049653756 17 Left 1049653749 8:143788776-143788798 CCACGCACCAGCTGTGAGCACTG No data
Right 1049653756 8:143788816-143788838 TGGCACCCTTTCTCCCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049653749 Original CRISPR CAGTGCTCACAGCTGGTGCG TGG (reversed) Intergenic
No off target data available for this crispr