ID: 1049654863

View in Genome Browser
Species Human (GRCh38)
Location 8:143792975-143792997
Sequence GCCTGAGGATGCCCCTGCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 376}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049654863_1049654867 -9 Left 1049654863 8:143792975-143792997 CCTGGGCAGGGGCATCCTCAGGC 0: 1
1: 0
2: 6
3: 45
4: 376
Right 1049654867 8:143792989-143793011 TCCTCAGGCGGGTGAGAAGTGGG 0: 1
1: 0
2: 1
3: 14
4: 188
1049654863_1049654871 14 Left 1049654863 8:143792975-143792997 CCTGGGCAGGGGCATCCTCAGGC 0: 1
1: 0
2: 6
3: 45
4: 376
Right 1049654871 8:143793012-143793034 CACGGCCGCGAAGGCCCTGTAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1049654863_1049654870 5 Left 1049654863 8:143792975-143792997 CCTGGGCAGGGGCATCCTCAGGC 0: 1
1: 0
2: 6
3: 45
4: 376
Right 1049654870 8:143793003-143793025 AGAAGTGGGCACGGCCGCGAAGG 0: 1
1: 0
2: 1
3: 2
4: 67
1049654863_1049654875 29 Left 1049654863 8:143792975-143792997 CCTGGGCAGGGGCATCCTCAGGC 0: 1
1: 0
2: 6
3: 45
4: 376
Right 1049654875 8:143793027-143793049 CCTGTAGGCCTGCTTCACATTGG 0: 1
1: 0
2: 0
3: 12
4: 96
1049654863_1049654866 -10 Left 1049654863 8:143792975-143792997 CCTGGGCAGGGGCATCCTCAGGC 0: 1
1: 0
2: 6
3: 45
4: 376
Right 1049654866 8:143792988-143793010 ATCCTCAGGCGGGTGAGAAGTGG 0: 1
1: 0
2: 0
3: 5
4: 145
1049654863_1049654869 -4 Left 1049654863 8:143792975-143792997 CCTGGGCAGGGGCATCCTCAGGC 0: 1
1: 0
2: 6
3: 45
4: 376
Right 1049654869 8:143792994-143793016 AGGCGGGTGAGAAGTGGGCACGG 0: 1
1: 0
2: 1
3: 35
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049654863 Original CRISPR GCCTGAGGATGCCCCTGCCC AGG (reversed) Exonic
900339057 1:2179199-2179221 GCCTGAGGATGTGCCTGGACCGG - Intronic
900610636 1:3543168-3543190 GCCTCAGGGTGCCCCGGCCCTGG - Intronic
900636776 1:3669782-3669804 CCCTGAGGATTCCCCAGCCTGGG - Intronic
900644645 1:3703380-3703402 GCCTGAGGAAGGCCCTGCTAAGG + Intronic
901020321 1:6252040-6252062 GGCTGAGGAGGCCACTGGCCGGG - Intronic
901188039 1:7387553-7387575 GCCTGAGGCTCACCCAGCCCAGG + Intronic
901297272 1:8170241-8170263 TCCTGGAGCTGCCCCTGCCCTGG - Intergenic
901799157 1:11697463-11697485 GCCAGAAGCAGCCCCTGCCCTGG - Intronic
903837660 1:26215994-26216016 GCCTCAGGAGGCTCCTGCCCTGG + Intergenic
904494969 1:30881435-30881457 GTCAGAGGATGCACCTGCCGAGG - Intronic
904957364 1:34296234-34296256 GCCTGAGGACAGCCCTGCTCTGG + Intergenic
906433183 1:45772748-45772770 CCCTGGGCATGCCACTGCCCAGG - Intergenic
907253124 1:53156511-53156533 GCCTCAGGATCCACCTGCCTCGG - Intergenic
907573673 1:55506730-55506752 GCCTGAGCATCCCCTTTCCCAGG - Intergenic
911089444 1:94006845-94006867 CCCAGAGGAAGCCTCTGCCCTGG - Intronic
912412402 1:109487999-109488021 GGCTGAGGGAGCCCATGCCCAGG + Intronic
916335336 1:163664802-163664824 GCCTGGGGCTGCCCCAGCTCTGG + Intergenic
916628358 1:166584182-166584204 GCCTGAGGCTGGCCCTGCGCTGG + Intergenic
919119810 1:193325250-193325272 GCCAGAGGATGCCACTGACCTGG + Intergenic
919613258 1:199773318-199773340 GCCTCAGGGTTCTCCTGCCCCGG + Intergenic
923386102 1:233466304-233466326 GCCTGCCGCTGCCCCTGCCCTGG + Intergenic
924442808 1:244100812-244100834 GGGTGAGGATGCTCCTGCCAGGG - Intergenic
924708734 1:246517959-246517981 GCCTGAGGATGGCACGTCCCAGG - Intergenic
1066337976 10:34499826-34499848 GCCTGAGAATGCTCCAGTCCTGG + Intronic
1066961758 10:42232445-42232467 GCCTGACCCTGCCCCTGCCTTGG - Intergenic
1067225870 10:44375329-44375351 GGCTGAAGAAGCCCCTTCCCAGG + Intronic
1067431763 10:46250019-46250041 GCCTGAAGATCCTGCTGCCCGGG + Intergenic
1067441657 10:46312155-46312177 GCCTGAAGATTCTGCTGCCCGGG - Intronic
1067472809 10:46548613-46548635 GACAGAGGCTGCCCCTGCCCTGG - Intergenic
1067788994 10:49273298-49273320 GCCAGAGGCTGCTCCTGCCCTGG - Intergenic
1067806049 10:49394623-49394645 ACCTCAGCATGCCCCTGCTCAGG - Intronic
1069842857 10:71350710-71350732 ACAGGAGGATGCCCCTGCCCTGG + Intronic
1070287599 10:75095097-75095119 GCCTGAGGAAGCACCTGGACTGG - Intronic
1071545017 10:86522167-86522189 GCCTGCGGAGGCCGCCGCCCGGG + Intergenic
1072534714 10:96353358-96353380 GCCTGGGAATGCCAGTGCCCTGG - Intronic
1072607933 10:96999515-96999537 GGGTGAGCATGTCCCTGCCCTGG - Exonic
1073110936 10:101062675-101062697 GCCTGGGGATGGCCTTGCGCCGG - Exonic
1073696698 10:105877252-105877274 GCCTGGAGATGCCCCTGGCCAGG - Intergenic
1074215615 10:111381286-111381308 GGCTGGCTATGCCCCTGCCCAGG + Intergenic
1074360808 10:112822986-112823008 CCCTGAGAATGACCTTGCCCGGG - Intergenic
1075671063 10:124264461-124264483 GCCTGGGGCTGTCTCTGCCCTGG + Intergenic
1075727850 10:124619762-124619784 GCCAGAGGGTGCCCGAGCCCCGG + Exonic
1075881029 10:125850901-125850923 GCCTGAGACTGCCGCTACCCTGG - Intronic
1076247445 10:128958440-128958462 GCCTGAGGAGCACCCTGGCCAGG - Intergenic
1076315445 10:129536905-129536927 GGCTGAGGATGGCCCTGCCAGGG + Intronic
1077010908 11:378917-378939 TCCTGAGGAGTCCCCTGCCTGGG - Intronic
1077106474 11:844567-844589 GCCTGAGGAGGGCCAGGCCCAGG - Exonic
1077229930 11:1454184-1454206 GTCTGGGGATGCCCCTCCACAGG - Intronic
1077327112 11:1968675-1968697 CCCTCAGGATGCCCACGCCCTGG - Intronic
1077343073 11:2034636-2034658 CCCTCAGGAGACCCCTGCCCAGG - Intergenic
1077479614 11:2807557-2807579 GCCCGAGGAGGGCCCGGCCCGGG - Intronic
1079202432 11:18387183-18387205 GCCTGAGGATGAGCCTTGCCTGG + Intergenic
1079414093 11:20216677-20216699 GCCTGATGGTGCCCACGCCCAGG - Intergenic
1080774809 11:35375700-35375722 ACCTGCTGATGCCACTGCCCGGG - Intronic
1080881213 11:36322681-36322703 ACCTGAGGCAGCCCTTGCCCAGG + Intronic
1081099677 11:38986517-38986539 GCCTGAGGATGGCCTGGCCCTGG - Intergenic
1081713839 11:45234573-45234595 ACCTGGGGATGCCCATCCCCTGG - Intronic
1083155571 11:60820909-60820931 GGCTGGGGCTGCCACTGCCCTGG + Intergenic
1083793600 11:65001821-65001843 GGCTGGGGATGTGCCTGCCCTGG - Intergenic
1083877441 11:65531736-65531758 GGCTGGGGAGGCACCTGCCCTGG + Intronic
1084004955 11:66317732-66317754 GGCTGAGGATGCCTGTGCCTGGG - Intergenic
1084175544 11:67420587-67420609 CCCTGAGTCTCCCCCTGCCCAGG + Exonic
1084692343 11:70734645-70734667 GCCAGAGGCTGCCCTGGCCCAGG + Intronic
1084858364 11:72003046-72003068 GCCAGAGGATGCTCTTTCCCAGG - Exonic
1085090419 11:73707785-73707807 GCTTGAGGATGCTCGAGCCCAGG + Intronic
1085150713 11:74250997-74251019 CCATGAGGATGCCCCTGACAAGG + Exonic
1085401144 11:76236209-76236231 GCCTGAGGCAGCCACTGTCCGGG - Intergenic
1085711222 11:78830603-78830625 GCCTGAGGTGGCCGCTGCTCGGG + Intronic
1088470157 11:110181791-110181813 GACTTAAAATGCCCCTGCCCTGG - Intronic
1089064709 11:115653728-115653750 ACCTGAGGATGCTGCTGCCTAGG + Intergenic
1089108706 11:116036893-116036915 GGCTGAGAATGCCCCTGGCAGGG + Intergenic
1089209368 11:116790111-116790133 CCCTGAGGATCTACCTGCCCAGG - Exonic
1089276204 11:117337683-117337705 ACCTGAGGAGGCTGCTGCCCAGG - Intronic
1089491452 11:118886691-118886713 CTCTGTGGATGCCCCAGCCCAGG - Intronic
1089499472 11:118923948-118923970 GCCTGAGCATGCTCCTCCTCTGG + Intronic
1202810094 11_KI270721v1_random:23855-23877 CCCTCAGGATGCCCACGCCCTGG - Intergenic
1202826059 11_KI270721v1_random:89825-89847 CCCTCAGGAGACCCCTGCCCAGG - Intergenic
1091591293 12:1844358-1844380 GCCTGAGACTGGCCCAGCCCCGG + Intronic
1091644614 12:2264220-2264242 GCCTGGGGATGCCTCTGCAAGGG + Intronic
1091719594 12:2803152-2803174 TCCTGAGGAAGCCTCTGCCTTGG - Exonic
1091757886 12:3067152-3067174 GTCTGTTGATGCACCTGCCCAGG - Intergenic
1092145772 12:6213742-6213764 GCCTGAGGGTGCAGCTTCCCAGG + Intronic
1093954283 12:25198187-25198209 GCCTGAGGATGCCCCAGTCCAGG - Intronic
1095344372 12:41132402-41132424 GACAGGGAATGCCCCTGCCCCGG + Intergenic
1096606087 12:52767543-52767565 GCCCTAGGCTGCCCCTGCCCAGG + Intergenic
1096618553 12:52848241-52848263 TCATGAGGCTTCCCCTGCCCAGG - Intronic
1098241550 12:68472519-68472541 GGCTGAGGCTGCCCCTGCTTGGG - Intergenic
1103741360 12:123093904-123093926 GGGTGGGGATGCCTCTGCCCAGG - Intronic
1104047863 12:125175850-125175872 GCCTTGAGATGACCCTGCCCTGG + Intergenic
1104055909 12:125229974-125229996 ACCTAAGGCTGCTCCTGCCCCGG - Intronic
1104805392 12:131586410-131586432 TCCTGAAGATGCCCCATCCCGGG + Intergenic
1104947726 12:132424054-132424076 GCCTGGGGATCCCGCAGCCCAGG - Intergenic
1105912503 13:24883725-24883747 GTCTGATCATGCCCCTTCCCAGG - Intronic
1106792404 13:33168953-33168975 GCCTGTGGTGGCTCCTGCCCCGG + Intronic
1107482199 13:40794467-40794489 GCCTGAGGCTCCCCCAGCACAGG + Intronic
1113170674 13:107499435-107499457 GCATGAGGATCCCCCAGCCCAGG - Intronic
1113442973 13:110343652-110343674 ACCTGAGGCTGAGCCTGCCCGGG + Intronic
1113604530 13:111595926-111595948 GCCAGAGGGTGGCCCTGACCTGG - Intronic
1113910619 13:113839628-113839650 GCCTGAGGATGGCCGTGCCCCGG + Intronic
1113955398 13:114097828-114097850 GCCTCAGGAAGGCCCTGCCTGGG + Intronic
1114302539 14:21391525-21391547 GGGTGAGGATGCCCCTCGCCGGG - Exonic
1114615660 14:24066923-24066945 ACCAGAGGCTGCACCTGCCCTGG - Intronic
1117342594 14:54804915-54804937 GGCTGAGGACGCCCCTCTCCTGG + Intergenic
1117464967 14:55983865-55983887 CCTTGAGCATACCCCTGCCCTGG - Intergenic
1121346904 14:93143011-93143033 GTCTGAGGCTGCCCATGCTCTGG - Intergenic
1123025201 14:105420723-105420745 CACGGAGGAAGCCCCTGCCCAGG - Intronic
1123826329 15:24086133-24086155 GGCTGGCGATGCCCCTGCTCAGG + Intergenic
1124621685 15:31277592-31277614 GCCTGAGGATGCCGGAGCACAGG - Intergenic
1124649705 15:31465586-31465608 GCCTGGGCATGCCCCTTGCCCGG - Intergenic
1125520726 15:40346544-40346566 GGTTCAGGATGCCCCAGCCCTGG - Intergenic
1126574388 15:50182911-50182933 CCCCGAGGATCGCCCTGCCCTGG + Intronic
1129116594 15:73368380-73368402 GCCTGAGGCTGCCCCCACGCCGG - Exonic
1129504021 15:76065958-76065980 GCCGAGGGGTGCCCCTGCCCAGG + Intronic
1129514190 15:76146918-76146940 CCGTGAGGAAGCCCCTGGCCCGG - Intronic
1129884952 15:79031333-79031355 GGCTGAGGGTGCCCCTCACCAGG - Intronic
1130116851 15:81012854-81012876 TCCTGAAGATGCACCTGGCCTGG + Intronic
1132017684 15:98333291-98333313 GGCTGGGGATGCCTCTGCCTTGG - Intergenic
1132295542 15:100731566-100731588 GCCTGCTGCCGCCCCTGCCCTGG - Intergenic
1132623704 16:880147-880169 GGCTCAGGATGCCCTTTCCCTGG + Intronic
1132668194 16:1091316-1091338 TCCTGATGCTGCTCCTGCCCGGG + Intronic
1132731770 16:1366418-1366440 GGCTCAGGAGGCCCCTGCCCAGG + Intronic
1132853788 16:2035941-2035963 GCCTGTGCGTCCCCCTGCCCCGG - Intronic
1133014362 16:2932567-2932589 ATCTGAGGTGGCCCCTGCCCTGG + Intronic
1134517414 16:14898284-14898306 GCCTTAGAATGGCACTGCCCTGG - Intronic
1134705083 16:16296939-16296961 GCCTTAGAATGGCACTGCCCTGG - Intergenic
1134758871 16:16695411-16695433 GCCAGTGGATGCCCTGGCCCAGG + Intergenic
1134962458 16:18415175-18415197 GCCTTAGAATGGCACTGCCCTGG + Intergenic
1134966755 16:18497774-18497796 GCCTTAGAATGGCACTGCCCTGG + Intronic
1134987204 16:18663773-18663795 GCCAGTGGATGCCCTGGCCCAGG - Intergenic
1135237766 16:20774737-20774759 GCCTGAGGATCAGCCTGCCTGGG - Intronic
1135546160 16:23368119-23368141 GGCTGAGGAAGCGCCTGGCCTGG - Intronic
1136284284 16:29232166-29232188 GGGTGAGGCTGCACCTGCCCAGG + Intergenic
1136474626 16:30505118-30505140 GGCTGTGGTTGGCCCTGCCCAGG - Intronic
1136526624 16:30835068-30835090 CCCTCAGGAGGCTCCTGCCCAGG - Exonic
1136841265 16:33544952-33544974 GCCTGACCGTGCCCCTGCCTTGG - Intergenic
1136863057 16:33714055-33714077 GCCTGACCCTGCCCCTGCCTTGG + Intergenic
1137013183 16:35344533-35344555 GGCTGCGGATGCCGCTGGCCGGG - Intergenic
1137676966 16:50308577-50308599 TCCCGAGGATACCCCTCCCCAGG + Intronic
1138429632 16:56960598-56960620 GACCGAGGGTGCCCCTGGCCAGG - Intergenic
1138555164 16:57766619-57766641 GCCTGGGGAGTCACCTGCCCAGG + Intronic
1138682415 16:58695188-58695210 CCCTGAGGAAGCCCAAGCCCAGG - Intergenic
1141372834 16:83503421-83503443 ATCTCAGGATGCCTCTGCCCAGG + Intronic
1141930400 16:87198405-87198427 GCCACAGGATGCTTCTGCCCAGG - Intronic
1142123710 16:88399887-88399909 TCCTGAGGTGGCCCCAGCCCTGG - Intergenic
1142174592 16:88639335-88639357 GCGTGGGGCTGCCCCTCCCCTGG + Intronic
1142422684 16:89982050-89982072 GCCTGAGGGTGGGACTGCCCAGG - Intergenic
1203151430 16_KI270728v1_random:1845249-1845271 GCCTGACCGTGCCCCTGCCTTGG - Intergenic
1142787897 17:2238699-2238721 GTCTGAGGAAGCCTCTTCCCTGG + Intronic
1143514934 17:7414795-7414817 GACGCAGGAGGCCCCTGCCCCGG - Exonic
1144654243 17:17025248-17025270 GGGTGGGGATGCCCCTGGCCAGG - Intergenic
1144829857 17:18125237-18125259 GCCTGGGGCTGGCCCTGCCCTGG + Intronic
1144950692 17:18992046-18992068 GCCTGCGCCTGCCCCAGCCCAGG + Intronic
1145120137 17:20251613-20251635 GCCTCAGAATGGCCCTGCACAGG + Intronic
1145760236 17:27421426-27421448 GCCTGAGGATGGCACGTCCCAGG + Intergenic
1145798819 17:27670900-27670922 GCCTGAGGATGGCACGTCCCGGG - Intergenic
1146004972 17:29155365-29155387 GACTGAGGCTGCCCCGGCCCTGG - Intronic
1146160253 17:30555698-30555720 GCCTGAGGATGGCACGTCCCAGG + Intergenic
1146266842 17:31458445-31458467 GCCTGAAGATGGCTCTGACCTGG + Intronic
1146374868 17:32287262-32287284 CCCTGAGGATGCACCTGCACAGG - Intronic
1150285306 17:63950724-63950746 GGCTGAGGCTGACCCTGCCTGGG - Intronic
1150291511 17:63985045-63985067 GCCTGAGCACGACCCTGCCAGGG - Intergenic
1151341129 17:73471688-73471710 TTCTGAAGATGCCCCTTCCCAGG + Intronic
1151602423 17:75114369-75114391 ACCTCAGGGTGCCCCTGTCCTGG - Intronic
1152073886 17:78147193-78147215 TGATGAGGATGCACCTGCCCAGG - Intronic
1152630865 17:81410204-81410226 GCCTGTGCACGCCCCTTCCCTGG + Intronic
1152710872 17:81870094-81870116 CCCAGAGGATGCCCCTGAGCAGG - Intronic
1152743188 17:82027455-82027477 GCCTCACCCTGCCCCTGCCCTGG - Intronic
1152761367 17:82108846-82108868 GCCCCACGCTGCCCCTGCCCTGG - Intronic
1152945702 17:83196365-83196387 GCCTTGGGATGCCCCTGACTTGG + Intergenic
1153343706 18:4003845-4003867 GCCTGAGGCTGCACCAGTCCTGG - Intronic
1153591922 18:6683293-6683315 GCCTGAGGATGCCCCGCCCCTGG + Intergenic
1153636327 18:7117062-7117084 GCCTGCGGGTCCCCCTGCCCGGG + Intronic
1153720205 18:7894058-7894080 GCCCAAGGAAGCCCCTCCCCTGG - Intronic
1154414926 18:14171478-14171500 GCCTGCTCCTGCCCCTGCCCTGG - Intergenic
1156458682 18:37309018-37309040 GTCTGAGGCTGGACCTGCCCAGG - Intronic
1158514998 18:58123511-58123533 CCCTGAGGAGACCCCCGCCCCGG + Intronic
1159123860 18:64200757-64200779 GCCTGCCCAGGCCCCTGCCCCGG + Intergenic
1160403353 18:78627965-78627987 CCCTGAGGAGGCCCCTTCCTTGG + Intergenic
1160502788 18:79410599-79410621 GCCTGATGGGGCCCCTGCCCTGG + Exonic
1160663203 19:311052-311074 GGGTGAGGAGGCACCTGCCCGGG - Intronic
1160775650 19:854067-854089 GACAGAGGCGGCCCCTGCCCTGG - Intronic
1161315340 19:3614869-3614891 CCCTGAGAATGCCCCTCCCCAGG + Intronic
1161352931 19:3803837-3803859 GCCTGAGGATGCCCACACCTTGG + Intergenic
1161420785 19:4174999-4175021 GTCTGAGCCTACCCCTGCCCAGG - Intronic
1161427216 19:4210209-4210231 GCCTAAGGTTGCCCCATCCCAGG - Intronic
1161592642 19:5135691-5135713 ACCGGGGGAGGCCCCTGCCCTGG - Intronic
1161659267 19:5536152-5536174 CCCAGAGGAGGCCCCTGACCTGG + Intergenic
1161708030 19:5831361-5831383 GCCTGAGGACTCACCTGCCTGGG - Exonic
1161723386 19:5915593-5915615 CCCTGTGGATGCCCCCGCCGAGG + Exonic
1161723525 19:5916092-5916114 GCCTCAGGAAGCCCCTGACCAGG - Exonic
1161865402 19:6829072-6829094 GCCTGGCTCTGCCCCTGCCCAGG - Intronic
1162344189 19:10110254-10110276 GCCCGGGGGTCCCCCTGCCCTGG - Intronic
1162503024 19:11065302-11065324 GCCTGGGGCTGCTCCTGGCCTGG - Intronic
1162556539 19:11389983-11390005 GCCTGATGATCCACCTGCCTTGG - Intronic
1162582838 19:11540872-11540894 GGCTGAGGTGGCACCTGCCCAGG - Intronic
1162792403 19:13069889-13069911 CCTTTAGGATGCCCCTCCCCAGG - Intronic
1163026891 19:14517900-14517922 GTCTGGGGCTGCCCCTCCCCGGG - Intronic
1163567466 19:18059944-18059966 ACCTGAGGGTGCCCCTGAGCTGG - Exonic
1163598250 19:18232919-18232941 GCTGCAGGAGGCCCCTGCCCCGG + Intronic
1163708786 19:18832957-18832979 GCCTGAGCAAGACCCGGCCCAGG - Intronic
1164671378 19:30074002-30074024 GCATGGGGAGGACCCTGCCCCGG + Intergenic
1165121249 19:33560216-33560238 CCCTGAGGCTGCCCCGGGCCTGG - Intergenic
1165431534 19:35775952-35775974 GCCTCAGGAGGCCCCTGCAGGGG - Intronic
1166175650 19:41067380-41067402 CCCTGATGAAGCCCCTGTCCTGG - Intergenic
1166284186 19:41813649-41813671 GCCTGGGGATGACCCTTCCGTGG - Intergenic
1166340784 19:42135373-42135395 CCCAGAGGCTGCCCCTGGCCTGG - Intronic
1167250469 19:48396265-48396287 GACTGGGGATGCCCCTCCTCAGG + Intronic
1167270035 19:48501357-48501379 GCCTGTGGATCCCACTGCGCTGG - Exonic
1167326810 19:48831721-48831743 GCCTGAGGAGACCTCTGCCCAGG - Exonic
1167782953 19:51612350-51612372 TCCTGGGGATGCCCCTCCCTTGG - Exonic
1168103919 19:54155442-54155464 GCATGCTGATCCCCCTGCCCAGG + Exonic
1168116291 19:54222819-54222841 GCCTGAGCAGGTCCCCGCCCGGG + Intronic
1168296403 19:55379122-55379144 AGGTGAGGCTGCCCCTGCCCTGG - Intergenic
1168687830 19:58358944-58358966 CCCTGAGGAGGCCACTGCCCTGG - Intronic
925152260 2:1623007-1623029 GCCTGGGGAAGCCCCTGGCAGGG - Intergenic
925832569 2:7910505-7910527 GCATCAGAATGCCCCTGCTCTGG - Intergenic
926086251 2:10022219-10022241 CCCTGAGGATGCCTCAGTCCTGG + Intergenic
931102209 2:59015140-59015162 GGCTGATGATGCCCCTGACCGGG + Intergenic
932468799 2:71940415-71940437 GCCCGAGAATGTCCCAGCCCTGG - Intergenic
933699356 2:85243653-85243675 GCCTGGGGCTGCCTCTGGCCAGG - Intronic
934156327 2:89204207-89204229 TCCAGAAGATTCCCCTGCCCAGG - Intergenic
934323181 2:91984664-91984686 GCCTGACCCTGCCCCTGCCTTGG + Intergenic
934618833 2:95791909-95791931 GCCCGAGGAGGGCCCTGACCTGG + Intergenic
934642060 2:96032648-96032670 GCCCGAGGAGGGCCCTGACCTGG - Intronic
934710685 2:96512114-96512136 GGCTGCAGATGCCCCTGTCCAGG - Intergenic
935543939 2:104380389-104380411 ACAAGAGGATGGCCCTGCCCAGG - Intergenic
936458311 2:112692534-112692556 CCCTGAGGAGGCACCTGACCTGG - Intergenic
937121018 2:119439985-119440007 AGCTGAAGATGCCCCTCCCCAGG - Exonic
937895186 2:126972487-126972509 GCCTTAAGATACGCCTGCCCAGG + Intergenic
937914258 2:127091265-127091287 GCCTGAGAATGCCCCGGGGCTGG - Intronic
937985221 2:127635308-127635330 GGCTGAGGCTGGCCCTGCCCTGG - Intronic
938080952 2:128369857-128369879 GCCTGTGGCTGTCCCTGCCCTGG + Intergenic
938101085 2:128498657-128498679 GCCTCAGGCTGCTCCTCCCCAGG - Intergenic
941935077 2:170975623-170975645 GCAGAAGGATGCCCGTGCCCAGG - Intergenic
942087076 2:172453666-172453688 CCCTGTCAATGCCCCTGCCCAGG - Intronic
942133960 2:172906997-172907019 GCCTGGGGCTGCTCCTGCCTGGG - Intronic
942947341 2:181684352-181684374 GCCTGAGGCTGGAGCTGCCCAGG + Intergenic
943615534 2:190087739-190087761 CTCTGAGGATGCCCCTGAGCAGG - Intronic
944645843 2:201780652-201780674 GCCCGAGGCGGCCCCTGCCTTGG - Intronic
945194726 2:207227459-207227481 GCGTGTGTCTGCCCCTGCCCGGG + Intergenic
945478382 2:210314982-210315004 GGCTGCGGCTGCCCCAGCCCCGG - Exonic
945974446 2:216259455-216259477 CCCTGAGCAGGGCCCTGCCCAGG - Exonic
946013907 2:216588607-216588629 CTCTGTGGATTCCCCTGCCCTGG - Intergenic
946177621 2:217931089-217931111 GAATGAGGATGGCCCCGCCCGGG + Intronic
947435430 2:230068432-230068454 GGCTGGGGCTGCCCCTTCCCGGG + Intronic
947874072 2:233457101-233457123 GCCTGGGGATGCCCTGGCCACGG + Intronic
948116952 2:235500415-235500437 TCCTGAGGATGCGGATGCCCTGG + Intronic
948190010 2:236051384-236051406 GCCTGAGGATGCCAGGGCTCGGG + Intronic
948327226 2:237134530-237134552 GCCTGAGGTTGCCTCAGGCCTGG + Intergenic
948674014 2:239586690-239586712 GTAAGAGGATGCACCTGCCCGGG - Intergenic
948777919 2:240299436-240299458 GCCTGAGGTGGGCCCTGACCTGG - Intergenic
948989633 2:241546992-241547014 GCATGCGGCTGGCCCTGCCCTGG + Intergenic
949004733 2:241638971-241638993 GGCTGGCGAGGCCCCTGCCCAGG + Intronic
1169039279 20:2479869-2479891 GCCTGAGGAAGCCCCTTCCAGGG + Intronic
1169059744 20:2652759-2652781 GCCTGCGCCTGCGCCTGCCCTGG + Intronic
1169990834 20:11500910-11500932 TCCTAATGATACCCCTGCCCCGG + Intergenic
1170892540 20:20388373-20388395 CCCTGGAGATGCCCCCGCCCTGG - Intergenic
1172835009 20:37867897-37867919 GCCTGAGGGTGCAGCTTCCCCGG + Intronic
1173825823 20:46047153-46047175 GCCTCAGAATGCACCTGGCCAGG + Intronic
1174230339 20:49041037-49041059 GCCTGTGGATACCCTTGCCTGGG - Intergenic
1175160669 20:57005389-57005411 GCCCCAGGATGCACCTGCTCAGG - Intergenic
1175312330 20:58020410-58020432 GCTCCAGGATGGCCCTGCCCTGG - Intergenic
1176154775 20:63613391-63613413 GCCTGTGTCTGCCACTGCCCTGG + Intronic
1176866059 21:14055876-14055898 GCCTGCTCCTGCCCCTGCCCTGG - Intergenic
1176866161 21:14056260-14056282 CCCTGGGCATGCCCTTGCCCTGG - Intergenic
1179812782 21:43883143-43883165 GCCTGGGGAGCCTCCTGCCCGGG + Intronic
1180075706 21:45460426-45460448 GGCAGAGGAAGCCCCAGCCCAGG - Intronic
1180549928 22:16530535-16530557 GCCTGACCCTGCCCCTGCCTTGG + Intergenic
1180841233 22:18959826-18959848 GCATGAGGATGCAGCTGGCCCGG + Intergenic
1180951178 22:19721310-19721332 CCATGCTGATGCCCCTGCCCTGG - Intronic
1181060264 22:20278968-20278990 GCATGAGGATGCAGCTGGCCCGG - Intronic
1181155315 22:20916736-20916758 CCCCGAGGCTTCCCCTGCCCCGG - Intergenic
1181670937 22:24425178-24425200 GCCCCAGGGTGCCCCAGCCCTGG + Intronic
1181808832 22:25391331-25391353 ACCTGCGGGTGCCCCTCCCCTGG - Intronic
1182558607 22:31142207-31142229 GCCTCAGGATACCCCTGGCCAGG + Intergenic
1182679398 22:32066990-32067012 GCCTGAAGCTGCCCCAGTCCCGG - Exonic
1183486241 22:38089077-38089099 GCCTGTGAGTGCCCCCGCCCCGG - Exonic
1183737500 22:39651918-39651940 GCCTGAGGCTGGACCTGCCCTGG - Intronic
1184045954 22:41972197-41972219 GTCTGGGGATCCCCCTGGCCCGG - Intergenic
1184358018 22:43995640-43995662 GCCTGTGGGTGCCCCTGAGCCGG + Intronic
1184634048 22:45812104-45812126 GCATGAGGATGACCAAGCCCAGG - Intronic
1184890186 22:47374562-47374584 TGCTGAGGAGGCCCCTGCCAGGG - Intergenic
1184992591 22:48180779-48180801 GCCAGCTGATGCCCTTGCCCTGG + Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
950046223 3:9950019-9950041 GCCTGGGAAAGCCCCTCCCCAGG + Exonic
950187736 3:10955806-10955828 GCCTTAGGATTCCCAGGCCCAGG - Intergenic
950490819 3:13303909-13303931 GCCTCAGGATGCCACTTCCAGGG + Intergenic
951016949 3:17742275-17742297 GCCTGAGGGTGCCGCCGCCACGG - Intronic
953381018 3:42473093-42473115 GGCTTAGGATTCACCTGCCCTGG + Intergenic
954137409 3:48588381-48588403 GCCTGAGGCTCCGCCAGCCCTGG - Exonic
954579769 3:51696915-51696937 GCCTGAGGCTGCCCCTCCAGGGG + Intronic
954671045 3:52291563-52291585 ACCTGAGGTTGCCCCTGCCTTGG - Intronic
954684350 3:52362289-52362311 CCCTGTTGATGCCCCTGTCCTGG - Intronic
954697588 3:52435866-52435888 GCCAGAGGAGCCCCCAGCCCGGG - Exonic
958120168 3:89276327-89276349 GAATGAGGATGCCTCTGCCTGGG + Intronic
960271207 3:115676447-115676469 GGCTGAAGATGCCCCAGCCAAGG + Exonic
960992574 3:123321620-123321642 GACAGAGGATGCCCCTTCCCTGG + Intronic
961645749 3:128391970-128391992 GCCTGAGTGTGCCCCAGCCGTGG + Intronic
961684367 3:128619088-128619110 GCCTGAATATCCACCTGCCCAGG + Intergenic
963803716 3:149701828-149701850 GCCTTATGATTCCCCTGCTCAGG - Intronic
964987718 3:162765659-162765681 AGCTGGTGATGCCCCTGCCCAGG + Intergenic
965547573 3:169931786-169931808 GCCTGGGGCTGCCCCTCCTCGGG + Intronic
965669559 3:171133080-171133102 GTTTGAGGATGCCCCTGCTCCGG + Intronic
966854312 3:184183802-184183824 GCCTCAGAACTCCCCTGCCCAGG - Exonic
967527546 3:190512845-190512867 CTCAGAGGCTGCCCCTGCCCTGG - Intergenic
968086404 3:195875879-195875901 GCCTAAGGCTGCCCCAGCTCTGG + Intronic
968446910 4:656820-656842 CCCTGAGGCTGGCCCTGGCCCGG - Intronic
968489725 4:883549-883571 GCCGGAGGCTGCGCTTGCCCGGG - Intronic
968516440 4:1017544-1017566 GCCCGAGGCAGCACCTGCCCAGG - Intronic
968917496 4:3502980-3503002 GCCTGAGACTGCCCCGGCCTTGG + Intergenic
968922649 4:3530690-3530712 CCCTCAGGCTGCCCCTGCACTGG - Intronic
969258500 4:6019285-6019307 GCCTGAGGATGCTCCCCACCTGG - Intergenic
969373510 4:6748582-6748604 TCCTGACGCTGCCCCTGCCCTGG - Intergenic
969479677 4:7441282-7441304 GCCTCAGGCTGCCCCTCACCTGG - Intronic
969699981 4:8762548-8762570 GCCACAGGGTGCCGCTGCCCAGG + Intergenic
972420022 4:38878291-38878313 GCCTCAGGATGCCAACGCCCTGG + Exonic
975578953 4:75889980-75890002 GCCTGACCATGCAACTGCCCTGG - Exonic
976605001 4:86974379-86974401 ACCTCAGGATGCGCCTGCCTCGG + Intronic
979218418 4:118193486-118193508 TCCTGAGGAAGCCTCTGCCTTGG + Intronic
981478719 4:145213950-145213972 GGCTGGTGATGCCCCTGCCTGGG + Intergenic
983904621 4:173169740-173169762 GCCTGGGGAAGCCCCTGCTGTGG + Intronic
985494904 5:198981-199003 GCCTCAGGGTTCACCTGCCCAGG + Exonic
985611824 5:893372-893394 CCCTGACCCTGCCCCTGCCCCGG + Intronic
985660544 5:1155018-1155040 GGCTGAGGAGGGCCCTGCCTGGG - Intergenic
985745362 5:1643748-1643770 GGCTGCAGATGCTCCTGCCCCGG + Intergenic
985951622 5:3225794-3225816 GCCTGGGGAGGCCCCGGCTCAGG + Intergenic
986518312 5:8586637-8586659 GCCTGAGGATGGCACATCCCGGG - Intergenic
987129764 5:14849740-14849762 GCCGGACGATCCCTCTGCCCTGG + Intronic
989101429 5:37826768-37826790 GCCTGCGGATGCTCCTGCTGTGG + Intronic
990124574 5:52498257-52498279 ACCTGAGGATACTTCTGCCCAGG + Intergenic
990382098 5:55228138-55228160 GCCTAAGGATGCCCCTCCCTAGG - Intergenic
992085717 5:73276478-73276500 GCCAAAGAATGCTCCTGCCCCGG + Intergenic
997404981 5:133638526-133638548 GCCTAAGGACGTCCCTTCCCAGG + Intergenic
997471432 5:134119589-134119611 GCCTGGGGATGCCCCAAGCCAGG + Intronic
997577938 5:134997213-134997235 GCCGGAGGCTGCCCCTCGCCTGG + Intronic
997633803 5:135389932-135389954 ACCTGAACATGCCCCGGCCCTGG + Intronic
997936873 5:138120027-138120049 GCCAGAGGATGCTTCAGCCCAGG - Intronic
998310422 5:141124014-141124036 CCCTGAGGCGGCCCCGGCCCAGG + Exonic
998311580 5:141137450-141137472 GCCGGAGGCGGCCCCGGCCCAGG + Exonic
998313556 5:141158019-141158041 CCCTGAGGCGGCCCCGGCCCAGG + Intergenic
998315625 5:141180056-141180078 TCCGGAGGCTGCCCCAGCCCAGG + Exonic
998320531 5:141225524-141225546 CCCTGAGGCGGCCCCGGCCCAGG + Exonic
999328737 5:150658957-150658979 GCCTGATGGTGTCCCTTCCCTGG - Intronic
999999111 5:157120539-157120561 GCCTGGGTATGCGCCTGCCATGG - Intronic
1001586183 5:172834910-172834932 GCCTGAGGCTCCCCCAGGCCGGG + Intronic
1003245119 6:4376590-4376612 GCCTGAGGATCTGCCTGCCTGGG - Intergenic
1004449900 6:15735590-15735612 GGCTGAAGCTGCTCCTGCCCTGG - Intergenic
1007113191 6:39325390-39325412 GGCTGAGGATGGCCCAGCCTTGG + Intergenic
1007113467 6:39327115-39327137 GGCTGAGGATGGCCCAGCCTTGG + Intergenic
1007145219 6:39622745-39622767 GCCTGAGGCTGCTCATGTCCAGG - Intronic
1007432276 6:41783584-41783606 CCCTGAGGATACCCATGCTCAGG + Exonic
1007470722 6:42088584-42088606 GCCTGAGCAGGCCCCAGCTCTGG + Intergenic
1007771274 6:44194350-44194372 TCCAGTGGATGCCCCTGCCCAGG - Intergenic
1007839259 6:44702115-44702137 TCCTGAAGTTGCCCCTCCCCGGG - Intergenic
1010028616 6:71248559-71248581 GCCTCAGGATGTTTCTGCCCTGG + Intergenic
1011243768 6:85300284-85300306 GTCTGATGATGTCCCTGCCATGG + Intergenic
1017021312 6:150142783-150142805 GCCAGGGGATGCTCCTGCGCGGG - Intergenic
1017761604 6:157573819-157573841 GCCCCAGGATGTCCCTGCCAGGG + Intronic
1018264956 6:162014382-162014404 GCCTGAAGAGGGCCTTGCCCAGG - Intronic
1019161242 6:170068203-170068225 GCTTGAGCCTGGCCCTGCCCTGG + Intergenic
1019194419 6:170272827-170272849 GGGAGAGGACGCCCCTGCCCTGG + Intergenic
1019258104 7:64455-64477 GCCTGGTGATGCCTCTGTCCTGG + Intergenic
1019274179 7:167199-167221 TCCTGAGGCTGCAGCTGCCCTGG + Intergenic
1020006554 7:4786452-4786474 GACTTACCATGCCCCTGCCCTGG - Intronic
1020277526 7:6633983-6634005 ACCTGAGGATGCCTCTGACCTGG - Intergenic
1021811586 7:24407020-24407042 GCCACAGGAGGCCACTGCCCAGG + Intergenic
1021861577 7:24910979-24911001 GTCTCAGGATGCCCTTGCCCTGG - Intronic
1024799284 7:53057661-53057683 ACCTGGGGCTGACCCTGCCCAGG + Intergenic
1025777369 7:64570546-64570568 GCCTGCGGCTGCACCGGCCCGGG + Intergenic
1026422965 7:70259558-70259580 GCCTGTTGATGCCCATGCCAGGG + Intronic
1026899404 7:74028523-74028545 GGCTGAGGGGGCCCCTGCTCAGG + Intronic
1028481656 7:91313282-91313304 CCATGAGGCTGGCCCTGCCCTGG + Intergenic
1029203338 7:98853699-98853721 CCATGAGGATGCCCCTCCCTGGG - Intronic
1031967108 7:128034428-128034450 GCCTGAGGAGACCCCTGGCCAGG + Intronic
1032241184 7:130160552-130160574 GCCTGAGGAGTCCCCTGACTCGG - Intergenic
1032758896 7:134919182-134919204 GCTTGGGGATCCGCCTGCCCTGG + Intronic
1034089718 7:148352605-148352627 GACTGAGCCTGCCCCTGCCCAGG - Intronic
1034182232 7:149147745-149147767 GGCTGAGGCGGCCCCGGCCCCGG + Exonic
1034995503 7:155574698-155574720 GGCTGCGGCTGCCCCTGCCCAGG - Intergenic
1035167418 7:156999993-157000015 TCCTGAGGACCCCCCGGCCCCGG - Intronic
1036549667 8:9805236-9805258 GCCTCAGGATGCCACAGCCCAGG + Intergenic
1036726678 8:11226926-11226948 GCCTGAGGGTGCCCCTAACTTGG - Intergenic
1039437173 8:37567648-37567670 GCCTGAGGATGAGCCAGCCCTGG + Intergenic
1039758151 8:40545077-40545099 GCCTAGAGATGCCCCTGGCCTGG + Intronic
1041151805 8:54943400-54943422 GGCTGATGATGCCCCTGCCCAGG + Intergenic
1041152461 8:54950091-54950113 GCCAGAGGATGCACCCGCCTGGG + Intergenic
1044109101 8:88249616-88249638 GCCTGAGAATGCCCTTCACCTGG + Intronic
1044754070 8:95443758-95443780 GCCTGGGGCTGCCCAAGCCCAGG - Intergenic
1045929585 8:107606039-107606061 GCCAGAGGCTCCCCCTGCACGGG - Intergenic
1047488165 8:125351469-125351491 ACCTCCAGATGCCCCTGCCCAGG - Intronic
1048854351 8:138673783-138673805 CCCTGGGCATGCACCTGCCCAGG + Intronic
1048899698 8:139025475-139025497 TCCTGAGGCTTCCCCAGCCCTGG + Intergenic
1049025777 8:139987907-139987929 GCCTCAGGAGACCCCTGGCCCGG - Intronic
1049167663 8:141136727-141136749 GCCTGAGGATGTCGCCGTCCCGG + Exonic
1049176421 8:141195368-141195390 CCCTCAGGATGCGCCAGCCCCGG - Exonic
1049322077 8:142001914-142001936 GCCTGCTGAGGCACCTGCCCAGG - Intergenic
1049372747 8:142275488-142275510 CCCTGGGGCTGCCCCGGCCCTGG - Intronic
1049473884 8:142788077-142788099 TCCTGAGAATGCTCCTGGCCGGG + Intergenic
1049654863 8:143792975-143792997 GCCTGAGGATGCCCCTGCCCAGG - Exonic
1049657679 8:143805957-143805979 GCCCCCGGATGCCCGTGCCCCGG + Intronic
1049795695 8:144496387-144496409 GCCCGGGGGAGCCCCTGCCCTGG - Intronic
1053666126 9:40319016-40319038 GCTGGATGGTGCCCCTGCCCTGG + Intronic
1053915711 9:42944063-42944085 GCTGGATGGTGCCCCTGCCCTGG + Intergenic
1054377280 9:64459044-64459066 GCTGGATGGTGCCCCTGCCCTGG + Intergenic
1054518483 9:66057267-66057289 GCTGGATGGTGCCCCTGCCCTGG - Intergenic
1056765839 9:89443888-89443910 CCCTGAGGATGCCCATGCCCAGG - Intronic
1057151303 9:92798466-92798488 GCCTGTGCATCCCTCTGCCCTGG - Intergenic
1057206818 9:93178444-93178466 GCCTCAGGTGGCCGCTGCCCTGG + Intergenic
1057250627 9:93498417-93498439 GACTGGGGATGTTCCTGCCCAGG - Intronic
1057613470 9:96567296-96567318 GCGCCAGGAGGCCCCTGCCCCGG - Intronic
1058814102 9:108668026-108668048 CCCTTAGGGTGCCCCTGCCAGGG - Intergenic
1059378795 9:113907482-113907504 GCCTGGGAAAGTCCCTGCCCGGG - Intronic
1061583973 9:131554747-131554769 CCCGGAGGACGCCCCGGCCCAGG + Intergenic
1061889385 9:133609540-133609562 GCCTGGGGGTGCCCCCACCCTGG + Intergenic
1062220200 9:135410934-135410956 TCCTGAGGTTCGCCCTGCCCTGG - Intergenic
1062563845 9:137154907-137154929 GCCTGTGCCTGCCACTGCCCAGG - Intronic
1185452791 X:291687-291709 GGCTGACGATGCCCCTGCCCCGG - Intronic
1188007082 X:25022869-25022891 CCCTGAGGAGGGCCCTGCCCGGG - Intergenic
1188593064 X:31863016-31863038 GCCTGAGGCTGCCCGCACCCAGG + Intronic
1190628096 X:52355905-52355927 GCCTGGGGCTGCCCTTGCCTAGG - Intergenic
1192928598 X:75781840-75781862 GCCTGGGGATGCCACTGCGCAGG - Intergenic
1193970060 X:88039661-88039683 GCCTGGGGATATACCTGCCCTGG + Intergenic
1195060748 X:101191625-101191647 GCCCGGGGAGGCCGCTGCCCGGG + Intergenic
1195278932 X:103310787-103310809 GCCTGCGGATGCCCCATCCCCGG - Exonic
1200014443 X:153147692-153147714 GACAGAGATTGCCCCTGCCCCGG - Intergenic
1200025159 X:153252262-153252284 GACAGAGATTGCCCCTGCCCCGG + Intergenic
1200164032 X:154023895-154023917 CCCAGAGGCTGCCCCAGCCCTGG + Intronic
1201190606 Y:11439652-11439674 GCCTGACCCTGCCCCTGCCTTGG + Intergenic