ID: 1049655247

View in Genome Browser
Species Human (GRCh38)
Location 8:143794316-143794338
Sequence AGGGCGCCACTGAGCCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049655247_1049655255 14 Left 1049655247 8:143794316-143794338 CCCTCAGGGCTCAGTGGCGCCCT 0: 1
1: 0
2: 0
3: 18
4: 219
Right 1049655255 8:143794353-143794375 TGACTGTGCTGTTGTTCATGAGG No data
1049655247_1049655257 22 Left 1049655247 8:143794316-143794338 CCCTCAGGGCTCAGTGGCGCCCT 0: 1
1: 0
2: 0
3: 18
4: 219
Right 1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG No data
1049655247_1049655256 21 Left 1049655247 8:143794316-143794338 CCCTCAGGGCTCAGTGGCGCCCT 0: 1
1: 0
2: 0
3: 18
4: 219
Right 1049655256 8:143794360-143794382 GCTGTTGTTCATGAGGATGAAGG No data
1049655247_1049655258 30 Left 1049655247 8:143794316-143794338 CCCTCAGGGCTCAGTGGCGCCCT 0: 1
1: 0
2: 0
3: 18
4: 219
Right 1049655258 8:143794369-143794391 CATGAGGATGAAGGGCCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049655247 Original CRISPR AGGGCGCCACTGAGCCCTGA GGG (reversed) Intronic
901024068 1:6269909-6269931 AGGGCGCCCCTGGGCACTCAGGG - Intronic
901129905 1:6955732-6955754 TGAGCCCCACTGAGCTCTGATGG + Intronic
901417734 1:9129097-9129119 AGGGCGCCTCGGTGCCCAGACGG - Exonic
901928067 1:12579424-12579446 AGGGAGCCACGGGGCCATGAGGG + Intronic
902377570 1:16037001-16037023 AGGGGGCCACAGAGCTCAGAGGG - Intergenic
902382745 1:16060260-16060282 AGGGGGCCACAGAGCTCGGAGGG - Intronic
902410629 1:16209811-16209833 TGGGCACCACTCAGCACTGAAGG - Intronic
902471134 1:16648095-16648117 AGGGCGCCTCTGAGCCGTCGGGG - Intergenic
902487669 1:16759350-16759372 AGGGCGCCTCTGAGCCGTCGAGG + Intronic
902653646 1:17852957-17852979 GGGGCTACAGTGAGCCCTGATGG - Intergenic
902733055 1:18382650-18382672 TGGGCTCCACTGACCCCTGAGGG + Intergenic
902772238 1:18652043-18652065 AGGGGGCCGGTGAGCCTTGATGG - Intronic
905491066 1:38344191-38344213 AAGATGCCACTGATCCCTGAAGG - Intergenic
905542495 1:38771574-38771596 CGGCCACCACAGAGCCCTGAGGG + Intergenic
905717221 1:40161935-40161957 GGAGCGCCACTGCCCCCTGAGGG + Intronic
906278122 1:44533420-44533442 AGGGCTGCAGTGAGCCCTGATGG + Intronic
906416769 1:45626060-45626082 AGGGCTACAGTGAGCCATGATGG - Intergenic
906539119 1:46571476-46571498 GGGGCTGCAGTGAGCCCTGATGG + Exonic
911249208 1:95556379-95556401 AAGGCTGCAGTGAGCCCTGATGG - Intergenic
915479054 1:156172819-156172841 AGGGGCCCACTGAGCACTAAAGG - Exonic
916128519 1:161591860-161591882 AGGGCTCCCCTTAGCCCTCAGGG - Intronic
916138437 1:161673691-161673713 AGGGCTCCCCTTAGCCCTCAGGG - Intronic
919008301 1:191928211-191928233 AGGGCATCTCTGAGCCCTGAGGG + Intergenic
919752745 1:201048406-201048428 AGGCTCCCTCTGAGCCCTGAGGG + Intronic
920382794 1:205545371-205545393 AGGGCCCTGCTGAGCCCTCAAGG + Intergenic
920851570 1:209631651-209631673 AGGGAGCCACCCAGCCCTGGTGG - Intronic
920944663 1:210516909-210516931 AGTGCTCCACTGAGCCATGGGGG + Intronic
921891121 1:220354890-220354912 AAGGCTCCAGTGAGCCTTGATGG - Intergenic
1063503389 10:6574877-6574899 ACGGCTCAACTGAGACCTGAAGG - Intronic
1064073086 10:12247149-12247171 AGGGGGACACGGTGCCCTGAGGG - Intronic
1067041518 10:42955652-42955674 AGGGCTCCACTGGGCCAGGAGGG - Intergenic
1067355572 10:45522271-45522293 GGAGGGCCACTGAGGCCTGAAGG + Intronic
1067762965 10:49063638-49063660 ATGGTGCCACTGGGCCCTGCTGG + Intronic
1068405434 10:56582398-56582420 AGGGCCACACAGTGCCCTGAAGG + Intergenic
1069789534 10:71010798-71010820 AGGAAGCCACTGAGCCCAGCCGG - Intergenic
1069815451 10:71191103-71191125 AGGGTGCCACACAGCCCTGCTGG + Intergenic
1071553436 10:86584902-86584924 ATGTAGTCACTGAGCCCTGAGGG + Intergenic
1081812099 11:45919945-45919967 TGTGAGCCACTGAGCCCTGCAGG + Intergenic
1083660970 11:64251607-64251629 GGGGACCCACGGAGCCCTGACGG - Exonic
1084517478 11:69644558-69644580 CGGGCTCAGCTGAGCCCTGAGGG + Intronic
1085539423 11:77253278-77253300 AAGCTGCCACTGAGCCCTGTTGG - Intronic
1086663614 11:89452777-89452799 GGGGCTGCAGTGAGCCCTGATGG - Intronic
1089311368 11:117560303-117560325 GGTGCGCCACTAAGCCCAGAGGG + Intronic
1093936207 12:25003413-25003435 AGGGCTTCAGTGAGCCATGAAGG - Intergenic
1094643956 12:32302996-32303018 AAGGCTGCAGTGAGCCCTGATGG - Intronic
1100195291 12:92238515-92238537 AAGGCTGCAGTGAGCCCTGATGG + Intergenic
1101527763 12:105547389-105547411 AGTGAGTCAATGAGCCCTGATGG + Intergenic
1102042691 12:109810769-109810791 GGGGCACGGCTGAGCCCTGAAGG - Intronic
1102954027 12:117048023-117048045 AGTGCACCACTGAGCCCAGCTGG + Intronic
1104421670 12:128641174-128641196 AGGGCACAAATGAGGCCTGAAGG - Intronic
1104647893 12:130509879-130509901 AGGGAGCCTCTGAGCCATCATGG - Intronic
1104689488 12:130814561-130814583 AGGGCACCAGTCAGCACTGAAGG + Intronic
1106439880 13:29756950-29756972 AGGGCAGCACTGAGCCACGAGGG - Intergenic
1106477064 13:30108072-30108094 AAGGCTCCAGTGAGCCGTGACGG + Intergenic
1110267842 13:73558537-73558559 AAGGCGGCAGTGAGCCGTGATGG + Intergenic
1113942694 13:114026633-114026655 CGGGCTCCCCTGAGCCATGATGG - Intronic
1113961703 13:114130001-114130023 AGGGGGCCACTGAGCCCCTCAGG - Intronic
1115334532 14:32231641-32231663 AGGGCCTCACAGAGCACTGAAGG - Intergenic
1118920070 14:70142010-70142032 AGGGCTCCACAGAGCCCAGCTGG + Intronic
1119448846 14:74690193-74690215 AAGGCTGCAGTGAGCCCTGATGG + Intronic
1120780021 14:88478997-88479019 AGGCCGCTACCGAGCCCGGAGGG - Exonic
1121013509 14:90535098-90535120 AGGTCCCCACGCAGCCCTGAGGG + Exonic
1122243128 14:100382301-100382323 AGGCCTTCACTGAGCCCTGCCGG - Intronic
1123056849 14:105574850-105574872 GGGGCACCTGTGAGCCCTGAGGG + Intergenic
1123081361 14:105696935-105696957 GGGGCACCTGTGAGCCCTGAGGG - Intergenic
1123632203 15:22269290-22269312 AGGGGGCCAGTGAGACCAGAGGG - Intergenic
1123707261 15:22959438-22959460 ATGCCGACACTGAGCCCAGAGGG + Intronic
1124604382 15:31160063-31160085 AGATCCCCACTGAGCCCTCAGGG + Intronic
1128465863 15:67910556-67910578 AGGACTGCAGTGAGCCCTGATGG + Intergenic
1129854378 15:78812945-78812967 AGGGAGCCACAGAGCCCTGGTGG - Intronic
1130555840 15:84922076-84922098 ATGATGCCACTGATCCCTGAAGG - Intronic
1130987436 15:88853952-88853974 ATGGGGCCCCTGAGCACTGAGGG - Intronic
1131204251 15:90428134-90428156 AGGGCTGCAGTGAGCCATGATGG - Intronic
1132523743 16:403811-403833 AAGGCGGCAGTGAGCCGTGATGG + Intronic
1132875856 16:2136671-2136693 AGTGAGCCACTGTGCCCTGCTGG - Intergenic
1132903386 16:2270213-2270235 AGGGCCCCACTGACACCTGGTGG + Intergenic
1133167859 16:3961383-3961405 AAGGCTGCAGTGAGCCCTGATGG + Intronic
1133585167 16:7187102-7187124 AGGGCTGCAGTGAGCCATGATGG + Intronic
1135889066 16:26341153-26341175 TGGGCACCACTGAGCCAGGATGG - Intergenic
1136005546 16:27326599-27326621 AAGGCTGCACTGAGCCGTGACGG + Intronic
1136414684 16:30096062-30096084 GGGGCGACACGCAGCCCTGACGG + Exonic
1137056089 16:35747298-35747320 AGGGGGCCACAGAAACCTGAGGG + Intergenic
1140286873 16:73611293-73611315 AGGGGGTCACTGACTCCTGAGGG + Intergenic
1141000532 16:80303300-80303322 ACGTGGCCACTGTGCCCTGATGG + Intergenic
1141699022 16:85633997-85634019 AGGGCGCCATTGAGCGGCGAGGG - Exonic
1142057484 16:88007413-88007435 AGGGCACCTCAGAGCCCTGCAGG - Intronic
1142236151 16:88923553-88923575 GGGGAGCAACTGAGCCGTGAGGG + Intronic
1142729870 17:1846380-1846402 AAGGCTACAGTGAGCCCTGATGG - Intronic
1145261619 17:21357955-21357977 AGGGGGCCTCTGAGGCCTGCAGG - Intergenic
1146304823 17:31722841-31722863 TGGGCTCCACTGAGCCATGCAGG - Intergenic
1147116514 17:38304409-38304431 AAGGCTGCAGTGAGCCCTGATGG + Intronic
1148413168 17:47485202-47485224 AAGGCTGCAGTGAGCCCTGATGG - Intergenic
1151652676 17:75479851-75479873 AAGGCTGCAGTGAGCCCTGATGG + Intronic
1152541641 17:80979695-80979717 GGGGGGCCACTGAGGCCTGGAGG - Intergenic
1152779097 17:82218539-82218561 AGGGGTGCACAGAGCCCTGAAGG + Intergenic
1155080746 18:22407634-22407656 GGGGCGCCACGAAGTCCTGAAGG - Intergenic
1156754010 18:40497723-40497745 AGGGTGCCACTCATCTCTGAAGG - Intergenic
1157088288 18:44604954-44604976 GGGGAGCCACTGGGGCCTGAAGG - Intergenic
1157768348 18:50322325-50322347 AAGGCTGCAGTGAGCCCTGATGG - Intergenic
1159014271 18:63088701-63088723 CTGCAGCCACTGAGCCCTGAAGG - Intergenic
1160141656 18:76328715-76328737 AAGACGCCACTGAGCCCTATTGG + Intergenic
1161089784 19:2354021-2354043 AGGGCTCCAGGGACCCCTGAGGG - Intronic
1161419902 19:4171053-4171075 AGGCCTCCGCTGAGCCCTAAAGG - Intronic
1161735911 19:5991947-5991969 AGGACCCCACTGTGTCCTGACGG - Intergenic
1161767775 19:6216552-6216574 AGGGCTCCACTGAGCCTCCAGGG + Intronic
1162536374 19:11264898-11264920 AGGGAGCCACTGTGCCCGGCGGG - Intergenic
1164566870 19:29332121-29332143 ATGGGACCACTGAGCCCTGTAGG - Intergenic
1165951346 19:39475479-39475501 AGGGCGCCGGAGAGCCATGAAGG + Intronic
1166121475 19:40689939-40689961 AGGGTGCCTCTGAGACCTGGGGG + Intronic
1166863845 19:45824521-45824543 AGGGCCCCACTGAACCCAAATGG + Intronic
1167654596 19:50755424-50755446 AGTGAGCCACTGTGCCCTGCTGG + Intergenic
1202703531 1_KI270713v1_random:4890-4912 AGGGCGCCTCTGAGCCGTCGAGG - Intergenic
925021730 2:575116-575138 AGGGGCTCAGTGAGCCCTGACGG + Intergenic
926357865 2:12057576-12057598 AGGGAACCACAGGGCCCTGAGGG + Intergenic
927646229 2:24878715-24878737 AGGCCGCCACTCAGCACAGATGG + Intronic
928772894 2:34722727-34722749 AAGGCTGCAGTGAGCCCTGATGG + Intergenic
931052422 2:58428863-58428885 AGCGCGCCACTCAGCCCGGGAGG + Intergenic
932713149 2:74082463-74082485 TGGGTGTCACTGAGCCCTGGTGG + Intronic
934070591 2:88380484-88380506 AAGGCTACACTGAGCCATGATGG - Intergenic
934690561 2:96355543-96355565 AGGGTGCTACTGAGCCTGGATGG - Intronic
935320817 2:101887417-101887439 AGGGCTCCACAGAGCCAGGAAGG - Intronic
937253999 2:120541849-120541871 AGTTAGCCACAGAGCCCTGAAGG + Intergenic
942030389 2:171953558-171953580 AGGCTGCCAGTGAGCCATGATGG + Intronic
942163886 2:173222139-173222161 AGGGCTGCAGTGAGCCATGATGG + Intronic
942358447 2:175145315-175145337 AGGACAGCACTGAGCCATGAGGG - Intronic
942444509 2:176069118-176069140 TGAGCCCCACTGAGCCCTGTAGG - Intergenic
942797728 2:179841356-179841378 AGCCCTGCACTGAGCCCTGATGG + Intronic
943578892 2:189661652-189661674 CGGGCGCCACTGGACCCTGAAGG + Intronic
948426033 2:237887040-237887062 AGGGCTTCACTGAGCCCCGAAGG + Intronic
948499318 2:238380272-238380294 AGGGCCTCTCTGAGCCCTGCAGG + Intronic
948499863 2:238384088-238384110 AGGGTGCCACTGAGCCAAGGAGG - Intronic
948505445 2:238424581-238424603 AGGGAGCCACTGGGACCTGGAGG + Intergenic
948800236 2:240430099-240430121 AGGGAGCCCCTGAGGCCTGTGGG - Intergenic
1169463766 20:5819755-5819777 AGGGCTGCAGTGAGCCATGATGG + Intronic
1170157889 20:13285224-13285246 AGGGCTGCAATGAGCCATGATGG + Intronic
1170743130 20:19075316-19075338 AAGGTGCCACTCAGCCCTGAGGG - Intergenic
1171781463 20:29422529-29422551 AGGACGGCACAGAGCCATGAGGG + Intergenic
1175899331 20:62353843-62353865 AGGGGCCCACTGAGCCCCCAGGG + Intronic
1176382366 21:6119806-6119828 GGGGTGCCACTGAGCCCCGCGGG - Exonic
1179741106 21:43418433-43418455 GGGGTGCCACTGAGCCCCGCGGG + Exonic
1180932449 22:19601796-19601818 AGGGCTCACCTGAGCCCAGAAGG - Intergenic
1183055289 22:35301160-35301182 AGGGCTGCAGTGAGCCCTGATGG + Intronic
1183716429 22:39535942-39535964 AGGGGGCCACTGGTCCCTGGGGG - Intergenic
1183831470 22:40420477-40420499 CGGGCGCCCCTGGGCCCTGTGGG - Exonic
1184071193 22:42148454-42148476 AAGGCTGCAGTGAGCCCTGATGG + Intergenic
1184390615 22:44201186-44201208 AGGGCCCCACAGAGCGCCGAGGG - Intronic
1184807339 22:46803511-46803533 AGGGCGACGCTGAACGCTGACGG - Intronic
949324027 3:2843578-2843600 AGGACGGCACTGAGCCGTGAAGG - Intronic
953490208 3:43343676-43343698 CGGTCCCCACTGAGCCCAGAAGG - Intronic
953497489 3:43400713-43400735 AAGGCTGCAGTGAGCCCTGATGG + Intronic
954298298 3:49686143-49686165 AGGGCGCCTCTGAGCCGTCGGGG + Exonic
954381482 3:50221314-50221336 TGGGGGCAGCTGAGCCCTGAGGG + Intergenic
954522076 3:51237446-51237468 AGGCCTCCAGTGAACCCTGATGG + Intronic
955075660 3:55610640-55610662 AAGGCTGCAGTGAGCCCTGATGG + Intronic
955954060 3:64270080-64270102 AGGGCCACATTGAGCCATGAGGG + Intronic
956084388 3:65594868-65594890 TGGGAGACACTGAGCACTGAAGG - Intronic
962388033 3:134948771-134948793 AAGGAGTCAGTGAGCCCTGAGGG - Intronic
962496416 3:135944863-135944885 AAGTTGCCACTGAGCCCTAATGG - Intergenic
966210668 3:177450321-177450343 AGGGCTGCACTGAGCCATGATGG - Intergenic
967413739 3:189194699-189194721 AAGCTGCCACTGAGCCCTGTTGG - Intronic
968629555 4:1642902-1642924 ATGGCGCCCCTGTGCCCTGCAGG - Intronic
968966786 4:3772820-3772842 GGGGTGGCACTGAGCCCTGCTGG - Intergenic
969839193 4:9868216-9868238 AGAGCGCCACTCATCTCTGATGG + Intronic
971594358 4:28509808-28509830 AAGGCTGCACTGAGCCATGATGG - Intergenic
972050727 4:34729626-34729648 TGGGCCCCAGTGACCCCTGAAGG + Intergenic
972775046 4:42232608-42232630 ATGGGGCCACTGAGCCCAGAAGG + Intergenic
974045338 4:56893745-56893767 AAGGCTCCAATGAGCCATGATGG - Intergenic
974069410 4:57110375-57110397 AGGGCGCGAGTGAGCCGTGTCGG + Exonic
975891550 4:79035010-79035032 TGTGAGCCACTGTGCCCTGATGG + Intergenic
976015406 4:80546622-80546644 AGGACAGCACTGAGCCATGATGG - Intronic
978630381 4:110737150-110737172 AGGGCGCAAGTGAGCTGTGATGG + Intergenic
978957397 4:114631198-114631220 TGTGAGCCACTGAGCCCTGCTGG - Intronic
981529493 4:145738166-145738188 CGTGAGCCACTGAGCCCTGCTGG - Intronic
982273282 4:153614116-153614138 CGGGCAGCACTGAGCCCTGCAGG + Intronic
983265366 4:165502242-165502264 AGGGCTACAGTGAGCCATGATGG - Intergenic
983630991 4:169849183-169849205 ATGGGGCCACTGAGCCCTAAAGG + Intergenic
984862774 4:184254970-184254992 TGGGCGCCACGGAGTCCAGAGGG + Intergenic
988949153 5:36241030-36241052 AGGGCGCCGCTGAGGGCTGCCGG - Intronic
989050297 5:37313563-37313585 GAGGCGCCACTTAGCCATGATGG - Intronic
991666848 5:69007947-69007969 ATGGCCCCACTGCCCCCTGATGG + Intergenic
992483029 5:77169780-77169802 ATGGTTCCACTGAGCCCTGGAGG + Intergenic
993943205 5:94086832-94086854 AGTGAGCCACTGACCCCTGCTGG + Intronic
995513026 5:112926800-112926822 AGGGCTCCAGTGAGCCATGATGG - Intergenic
995986690 5:118184783-118184805 CAGGCGCCACTGAGCCCTAATGG - Intergenic
998320647 5:141226630-141226652 AAGGCGGCAGTGAGCCATGATGG - Intergenic
1002469908 5:179428971-179428993 AGGGCTCCTCCCAGCCCTGATGG - Intergenic
1002674574 5:180900583-180900605 AGAGCCCCACACAGCCCTGAAGG + Intronic
1003293706 6:4805373-4805395 AGTGTGGCTCTGAGCCCTGATGG - Intronic
1006277707 6:33019400-33019422 AGCTGGCCACTGAGCCCAGAGGG + Intergenic
1006436338 6:34027785-34027807 AGGGGGCGCCTGGGCCCTGAGGG - Intronic
1010427519 6:75743572-75743594 AAGGCGGCACTGAGGCATGACGG + Intergenic
1011260050 6:85461441-85461463 AGCGAGCCACAAAGCCCTGAAGG + Intronic
1015518354 6:134107315-134107337 AGGGCGATACTTAGCTCTGAGGG + Intergenic
1019438262 7:1032695-1032717 AGGGCACCACTGTCACCTGAGGG - Intronic
1019920428 7:4159639-4159661 AGGGCCCTAGTGAGCCCTGCTGG + Intronic
1020128769 7:5547889-5547911 ATGCTGACACTGAGCCCTGAAGG - Intronic
1020224198 7:6267005-6267027 AGGGCAGCACTGAGCCATGAGGG - Intronic
1020342982 7:7132498-7132520 AGGGAGCACCTGAGCTCTGAGGG + Intergenic
1020533481 7:9364250-9364272 AGGGGGCCAATGAGTCCTCAGGG + Intergenic
1021826711 7:24560752-24560774 AGGGAGCCACGGAGCCCTGCTGG - Intergenic
1022394471 7:29973577-29973599 AGGTCCACACTGAGCCTTGAAGG + Intronic
1023522652 7:41064390-41064412 AGGGCAAAACTGAGTCCTGACGG - Intergenic
1024423733 7:49201536-49201558 AGTGAGCCACTGAGCCCTCTGGG + Intergenic
1027183063 7:75953021-75953043 TGGGCACCATTGAGCACTGAGGG + Intronic
1028789042 7:94832661-94832683 AAGGCTGCACTGAGCCCTGATGG - Intergenic
1029873789 7:103725501-103725523 AGGGCTGCAGTGAGCCATGATGG + Intronic
1033009647 7:137607053-137607075 AAGGCACCACTGAGCCTCGAAGG + Intronic
1036694901 8:10968002-10968024 AGGTGGCCCCTGAGCCCGGAGGG - Intronic
1039885863 8:41653728-41653750 GGGGCGCCTCTGCGCCCTGGAGG + Intronic
1040386708 8:46919124-46919146 AGGGCGCCACTGTCCCCTCTGGG + Intergenic
1040911364 8:52522189-52522211 AGGGCTTCACTGAGGCCTGTTGG - Intergenic
1042138379 8:65653996-65654018 AGGGCTGCAGTGAGCTCTGATGG + Intronic
1042232394 8:66571598-66571620 AGTGAGCCACTGCGCCCTGTCGG - Intronic
1042418502 8:68556617-68556639 AGGGCACCTCTGAGGCCTGCTGG + Intronic
1044507509 8:93038905-93038927 TGGGCACCATTGAGCACTGAGGG - Intergenic
1045547289 8:103140579-103140601 GGGCCGTCACGGAGCCCTGAGGG + Intronic
1049156042 8:141067391-141067413 TGGGCACAACTGGGCCCTGAGGG + Intergenic
1049434446 8:142579955-142579977 AGGTGGCCCCTGAGCCCAGATGG + Intergenic
1049655247 8:143794316-143794338 AGGGCGCCACTGAGCCCTGAGGG - Intronic
1049814167 8:144590388-144590410 AAGACGGCACTGAGCCATGAGGG - Intronic
1059056442 9:110986248-110986270 AGGGCGCCACTGTGCCAAGCTGG + Intronic
1059247838 9:112863364-112863386 AGCACTTCACTGAGCCCTGATGG - Intronic
1060553414 9:124496353-124496375 AGGGCGACAAGGAGGCCTGAGGG - Intronic
1060794805 9:126506456-126506478 CGGCCGCCACTGGGCCCTGCCGG + Exonic
1061024125 9:128036480-128036502 CGTGAGCCACTGTGCCCTGACGG - Intergenic
1061119925 9:128636115-128636137 AGGTCTGCAGTGAGCCCTGAGGG - Intronic
1061678523 9:132231428-132231450 GGGGCCCCACAGAGCCCTGGTGG - Intronic
1061892907 9:133632078-133632100 AAGGGGCCACTGATCCCAGAAGG - Intergenic
1062034758 9:134378038-134378060 AGGGCACCACTGTGCCCCCATGG - Intronic
1062474071 9:136718993-136719015 AGGGGGCCTCTGAGCCCAGCAGG + Intronic
1062566839 9:137167329-137167351 AGGGCGGCACTGGGCGCTGAGGG + Intronic
1187467788 X:19542103-19542125 AGGGCGCCGCTGAGGACAGAGGG + Exonic
1189235360 X:39482843-39482865 AAGAGGCCACTGAGCCATGAAGG + Intergenic
1192221596 X:69200908-69200930 AGAGGGCCACTGAGCTTTGAGGG + Intergenic
1195011049 X:100732210-100732232 AGGGGGCCACTCAGCCCAAAAGG + Intergenic
1199419610 X:147629757-147629779 AGGGAGAAACTGAGGCCTGAAGG + Intergenic
1201854590 Y:18527612-18527634 TGGGGGCCCCTGGGCCCTGAAGG + Intergenic
1201878731 Y:18792773-18792795 TGGGGGCCCCTGGGCCCTGAAGG - Intronic