ID: 1049655248

View in Genome Browser
Species Human (GRCh38)
Location 8:143794317-143794339
Sequence CAGGGCGCCACTGAGCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 270}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049655248_1049655257 21 Left 1049655248 8:143794317-143794339 CCTCAGGGCTCAGTGGCGCCCTG 0: 1
1: 0
2: 5
3: 38
4: 270
Right 1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG No data
1049655248_1049655258 29 Left 1049655248 8:143794317-143794339 CCTCAGGGCTCAGTGGCGCCCTG 0: 1
1: 0
2: 5
3: 38
4: 270
Right 1049655258 8:143794369-143794391 CATGAGGATGAAGGGCCTCCCGG No data
1049655248_1049655256 20 Left 1049655248 8:143794317-143794339 CCTCAGGGCTCAGTGGCGCCCTG 0: 1
1: 0
2: 5
3: 38
4: 270
Right 1049655256 8:143794360-143794382 GCTGTTGTTCATGAGGATGAAGG No data
1049655248_1049655255 13 Left 1049655248 8:143794317-143794339 CCTCAGGGCTCAGTGGCGCCCTG 0: 1
1: 0
2: 5
3: 38
4: 270
Right 1049655255 8:143794353-143794375 TGACTGTGCTGTTGTTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049655248 Original CRISPR CAGGGCGCCACTGAGCCCTG AGG (reversed) Intronic
900344859 1:2205725-2205747 GGGCGCGCCACTGAGGCCTGCGG - Intronic
900399209 1:2466175-2466197 CCGGGACCCACTGAGACCTGGGG + Intronic
900578621 1:3396563-3396585 CCGGGCGGCACTGTGCCCAGGGG - Exonic
900616940 1:3569691-3569713 CAGGCAGCCACTGAGCCCGGTGG - Intronic
901038418 1:6349951-6349973 CCGGGAGCCATTGAGCCCTTTGG - Intronic
901055811 1:6448222-6448244 CAGGGCTCCGCGGAGCCCTGGGG + Intronic
902471135 1:16648096-16648118 CAGGGCGCCTCTGAGCCGTCGGG - Intergenic
902478583 1:16700416-16700438 CAGGGCTCCGCGGAGCCCTGGGG - Intergenic
902733054 1:18382649-18382671 TTGGGCTCCACTGACCCCTGAGG + Intergenic
902791466 1:18771343-18771365 CAGGGAGCAGCTGAGCCATGCGG + Intergenic
903786043 1:25862066-25862088 CAGGTCACCACTGGGCCCTGTGG - Exonic
904384804 1:30134374-30134396 CGGGGGGCCCTTGAGCCCTGGGG + Intergenic
904906540 1:33901396-33901418 CAGGACTCTACTGAGCCCTGAGG + Intronic
907946309 1:59139584-59139606 CAGGTTGCCACTTACCCCTGGGG - Intergenic
911275362 1:95853005-95853027 CAGGCTGCCCCTGAGCACTGGGG + Intergenic
912468768 1:109892480-109892502 CAGGCAGCTTCTGAGCCCTGGGG + Intergenic
913076928 1:115348149-115348171 CAGGGAGCAAGTGAGACCTGGGG + Intergenic
917853134 1:179082180-179082202 CCGGGCGCGCCTGAGCCCCGCGG + Exonic
919008300 1:191928210-191928232 GAGGGCATCTCTGAGCCCTGAGG + Intergenic
919743680 1:200995345-200995367 CTGGGCTCCACTGAGGGCTGAGG + Intronic
919752744 1:201048405-201048427 CAGGCTCCCTCTGAGCCCTGAGG + Intronic
920944662 1:210516908-210516930 GAGTGCTCCACTGAGCCATGGGG + Intronic
1062774293 10:132860-132882 GCGGGTGCCACTGAGCCCTGGGG - Intergenic
1065798224 10:29326930-29326952 CTGGGAGCCACTGAGTCCTAGGG - Intergenic
1065816561 10:29488039-29488061 CAGGGCGTCTCTGGGCCATGAGG - Intronic
1067041519 10:42955653-42955675 CAGGGCTCCACTGGGCCAGGAGG - Intergenic
1067045289 10:42981926-42981948 CCAGGCCCCACTGAGCCATGGGG + Intergenic
1067595538 10:47554169-47554191 CAGGGCGCCTGTGGTCCCTGTGG + Intergenic
1069724166 10:70566762-70566784 CAGGGCCCCACGCAGGCCTGGGG + Exonic
1071565751 10:86670524-86670546 CTGAGTGCCACTGAGCCCAGTGG - Intronic
1072719596 10:97772217-97772239 CAGGGAGGCAGGGAGCCCTGGGG - Intergenic
1075065385 10:119285787-119285809 CAGGGAGCCGCTGAGTGCTGGGG + Intronic
1075763031 10:124871118-124871140 CAGAGCTGCACTGAGACCTGAGG - Intergenic
1076732023 10:132443980-132444002 CAGGAAGCCAGGGAGCCCTGAGG - Intergenic
1076765794 10:132632327-132632349 CAGGGCGCCTGTGTCCCCTGTGG + Intronic
1076917621 10:133432509-133432531 CAGGGTGCCCCTGGCCCCTGGGG - Intergenic
1076937619 10:133576584-133576606 CAGGGTGCCCCTGGCCCCTGGGG - Intergenic
1077308885 11:1879829-1879851 CTGGGCACCCCTGTGCCCTGTGG - Intronic
1077366334 11:2162785-2162807 CAGGACGCCACAGTGCTCTGAGG + Intergenic
1077414547 11:2418599-2418621 CAGGGCACCCGTGAGGCCTGAGG + Intronic
1077787698 11:5402561-5402583 CAAGGTGGCACTGATCCCTGAGG + Intronic
1078566435 11:12418326-12418348 CAGGAAGCCACAGAGGCCTGTGG - Intronic
1080734577 11:35000361-35000383 CAGGGTACCACTGCGGCCTGGGG + Intronic
1080742383 11:35078611-35078633 CAGGTCTGCACTGAGCTCTGAGG + Intergenic
1081136217 11:39442507-39442529 CAGCCCGCCACTGAGCTGTGGGG - Intergenic
1081631978 11:44695519-44695541 CAGGGCAAGCCTGAGCCCTGTGG - Intergenic
1083992220 11:66253501-66253523 CAGGGGGCTGCTGAGCACTGTGG + Intergenic
1084517477 11:69644557-69644579 CCGGGCTCAGCTGAGCCCTGAGG + Intronic
1084563252 11:69915745-69915767 CAGGGAGACACTGAGGCTTGGGG - Intergenic
1085728900 11:78979422-78979444 CAAGGGGCCACTGAGCCCCAAGG - Intronic
1088776631 11:113091277-113091299 CAGGGAGCCACTGAGCTGGGAGG - Intronic
1089493448 11:118897268-118897290 CATGGTGCCACTGGGGCCTGTGG - Exonic
1089793131 11:120958629-120958651 CGAGGCTCCACTGAGCCCTCCGG + Intronic
1090478342 11:127045564-127045586 CTGGGCCCCACTGGGCCATGAGG - Intergenic
1090606189 11:128425024-128425046 GAGAGCTCCACTGAGGCCTGTGG - Intergenic
1090794369 11:130122161-130122183 CACCGTGCCACTAAGCCCTGGGG - Intronic
1091284628 11:134401827-134401849 CTGGTCGCCACTGAGCCATGAGG - Intronic
1092237822 12:6821018-6821040 CAGGCCCACACAGAGCCCTGTGG - Intergenic
1093573612 12:20698777-20698799 CAGGCAGGCACTGAGCCATGTGG + Intronic
1094526310 12:31233561-31233583 CAGGGCACCACGGAGGGCTGGGG + Intergenic
1096134574 12:49188752-49188774 CAGGGCGCAGCAGAGCGCTGGGG - Intronic
1103362079 12:120360403-120360425 CAGGACCCCACTGAGCCAGGAGG + Intronic
1103960095 12:124603983-124604005 CAGGGCCCCTCTGCGGCCTGAGG + Intergenic
1105589353 13:21776720-21776742 GAGGGCCCCACGGAGCCTTGTGG + Intergenic
1108070605 13:46625128-46625150 CAGGGCGCCACTAGGCACTTGGG - Intronic
1111072020 13:83182867-83182889 AAAGGCGCCACTGACCCCAGAGG - Intergenic
1114266407 14:21074918-21074940 CAGTGCCCCACTGAGCCCTGGGG + Exonic
1116152188 14:41154683-41154705 CAGCCCGCCACTGAGCTGTGGGG - Intergenic
1117508965 14:56429579-56429601 CAGAGCCCCACTCTGCCCTGAGG - Intergenic
1120780022 14:88478998-88479020 CAGGCCGCTACCGAGCCCGGAGG - Exonic
1121889032 14:97572219-97572241 CAGTGCTCCACAGAGCTCTGGGG + Intergenic
1122691216 14:103532969-103532991 CAGGGCCCCACTTTGGCCTGAGG + Intronic
1122874471 14:104657311-104657333 CAGGGAACATCTGAGCCCTGCGG - Intergenic
1122890004 14:104727823-104727845 CAGGGCGCGCTGGAGCCCTGTGG - Intronic
1122929920 14:104928441-104928463 CCTGGCCCCACTCAGCCCTGAGG - Intronic
1122953160 14:105056870-105056892 CAGGGCTCCCCTGGGACCTGTGG + Intronic
1123056848 14:105574849-105574871 CGGGGCACCTGTGAGCCCTGAGG + Intergenic
1123081362 14:105696936-105696958 CGGGGCACCTGTGAGCCCTGAGG - Intergenic
1125521504 15:40350376-40350398 CCGGTCCCCACTGACCCCTGTGG - Intergenic
1125749429 15:42018756-42018778 CAGGACTCCACTGCCCCCTGGGG + Intronic
1125789512 15:42353169-42353191 CAGGGAGCCACTGAGGTCTGTGG - Exonic
1126165593 15:45651449-45651471 CAGGCCGCCACTGCGCTGTGGGG - Intronic
1126189216 15:45862289-45862311 CAGGGCATTACTGACCCCTGAGG + Intergenic
1127626098 15:60781662-60781684 CAGGGAGGCACTCAGCCCAGGGG - Intronic
1129586911 15:76876257-76876279 CAGCCCGCCACTGAGCTGTGGGG - Intronic
1130144240 15:81261342-81261364 CAGGGAGCCAGGGAGCTCTGCGG - Intronic
1130144249 15:81261369-81261391 CAGAGAGCCAGGGAGCCCTGGGG - Intronic
1130193938 15:81761544-81761566 TAGGGCTCCTCTGAGCACTGTGG - Intergenic
1130969168 15:88718721-88718743 CAGTGGGCAACTGAGCCTTGAGG - Intergenic
1131522586 15:93127445-93127467 CAGGGGGTCACTGAGGACTGGGG + Intergenic
1132709856 16:1261603-1261625 CCGGTCGCCAGTGTGCCCTGAGG + Intergenic
1132795763 16:1721496-1721518 CGGGGCTGCAGTGAGCCCTGAGG - Intronic
1133193722 16:4153456-4153478 CAGGGCGACACTGTGTCTTGGGG + Intergenic
1135945833 16:26864104-26864126 CAGGGAGCTACAGAGCCCAGTGG + Intergenic
1135993373 16:27230797-27230819 CAGGGCGCCTCTGAGCTCGAGGG - Intronic
1136249042 16:28991716-28991738 CAGGGAGACACTGAGCACAGTGG - Intergenic
1136340691 16:29641112-29641134 CAGGGTTCCTCAGAGCCCTGGGG - Intergenic
1137012761 16:35339923-35339945 AAGGGCAGCACAGAGCCCTGAGG + Intergenic
1137056088 16:35747297-35747319 CAGGGGGCCACAGAAACCTGAGG + Intergenic
1137522604 16:49207901-49207923 CAGGGAGCCCCTGTGTCCTGGGG + Intergenic
1137908791 16:52354343-52354365 CAGCTCTCCACTGAGCCTTGTGG + Intergenic
1138551133 16:57749117-57749139 CAGAGGGGCACTGAGGCCTGGGG + Intronic
1139299719 16:65934598-65934620 CAAGGAGCCCCTGAGGCCTGGGG + Intergenic
1141631723 16:85291552-85291574 CAAGCCGGCCCTGAGCCCTGTGG - Intergenic
1141699023 16:85633998-85634020 CAGGGCGCCATTGAGCGGCGAGG - Exonic
1142685368 17:1574593-1574615 CAGGGCCCCACGGAGCCCGCCGG + Exonic
1142699500 17:1650445-1650467 CAGGTCTCCACTGAGTCCAGGGG + Intergenic
1142741530 17:1934534-1934556 CAGTGCGCCCCTGCCCCCTGCGG + Intergenic
1144829029 17:18121537-18121559 CAGGGCGTCTCTGAGTCCTCGGG - Exonic
1146122657 17:30209174-30209196 CAGCGCGACAGTGAGCACTGCGG + Exonic
1147175857 17:38655781-38655803 CCAGGCCCCACTGAGCCCTCTGG + Intergenic
1147440094 17:40442845-40442867 CAGGGCCCAAATGCGCCCTGGGG + Intergenic
1147538234 17:41334770-41334792 CAGGGCTCCACAAGGCCCTGTGG - Intergenic
1147806472 17:43135276-43135298 CAGGGAGCCACAGAGCGCAGCGG + Intergenic
1147921093 17:43917563-43917585 CAGGGAGCCACAGAGCGCAGCGG + Exonic
1148168554 17:45501187-45501209 CAGGGAGCCACAGAGCGCAGCGG + Intergenic
1148280258 17:46341753-46341775 CAGGGAGCCACAGAGCGCAGCGG - Intronic
1148302486 17:46559690-46559712 CAGGGAGCCACAGAGCGCAGCGG - Intronic
1150399747 17:64847638-64847660 CAGGGAGCCACAGAGCGCAGCGG + Intergenic
1151383510 17:73741474-73741496 CTGCTCCCCACTGAGCCCTGAGG + Intergenic
1151472533 17:74326943-74326965 CATGGCCCCACAGAGCCCTGGGG + Intronic
1151560198 17:74865897-74865919 CTGGTCCCCACTGTGCCCTGGGG + Intronic
1151671689 17:75574539-75574561 CAGCGCTCCCCTGAGCCCTCTGG - Intronic
1152521049 17:80857222-80857244 CTGGGCGCCAGTGAGCCCCTGGG + Intronic
1152676891 17:81645982-81646004 CAGGGCCCCAATCAGCCCTGCGG + Intronic
1155079340 18:22392204-22392226 AAGGGAGCCAATGAGCCCAGAGG + Intergenic
1155143734 18:23066575-23066597 CTGGGCTACACTGATCCCTGGGG - Intergenic
1156269181 18:35515365-35515387 CAGGACTCCACAGAGCACTGTGG + Intergenic
1156463765 18:37336057-37336079 CAGCGCACTTCTGAGCCCTGAGG + Intronic
1156884235 18:42115675-42115697 CAGGACGTCACTGAATCCTGGGG - Intergenic
1160426795 18:78783360-78783382 CAGCAGGCCACAGAGCCCTGCGG - Intergenic
1160562889 18:79770677-79770699 CATGGCGCCACAGTGTCCTGGGG - Intergenic
1160843313 19:1155967-1155989 CAGGGCGCTCCTCAGCTCTGAGG + Intronic
1161055641 19:2189488-2189510 CAGGGAAGCACTGAGCCCTGAGG - Intronic
1161089785 19:2354022-2354044 CAGGGCTCCAGGGACCCCTGAGG - Intronic
1161767774 19:6216551-6216573 CAGGGCTCCACTGAGCCTCCAGG + Intronic
1162536375 19:11264899-11264921 CAGGGAGCCACTGTGCCCGGCGG - Intergenic
1162957204 19:14106011-14106033 CAGGGCCCTTCTGACCCCTGGGG + Intronic
1163106497 19:15125744-15125766 CGGGGCGCCGCTGAGCCAAGTGG - Exonic
1163491868 19:17621557-17621579 CAGGGCTCAGATGAGCCCTGTGG + Intronic
1163546987 19:17946568-17946590 CAGCCCCTCACTGAGCCCTGGGG + Intergenic
1165621495 19:37252106-37252128 CCGGGCGCCCATGAGACCTGTGG - Intergenic
1165901778 19:39172671-39172693 CAGGGTCCCACCGAGCCCAGGGG + Intronic
1166121474 19:40689938-40689960 CAGGGTGCCTCTGAGACCTGGGG + Intronic
1166945279 19:46392308-46392330 CAGGGCGCACCTGAGGGCTGAGG + Intronic
1167311956 19:48741956-48741978 CAAGGGGTCACTGAGGCCTGAGG + Intronic
1168132524 19:54330561-54330583 CAGGGAGTCAGTGAGCTCTGGGG + Intergenic
1168629677 19:57947238-57947260 AGAGGCGCCACTGAGCCCTGGGG - Intronic
1202712602 1_KI270714v1_random:26247-26269 CAGGGCTCCGCGGAGCCCTGGGG - Intergenic
926590247 2:14733164-14733186 CAGGGCCTCACTGGACCCTGAGG + Intergenic
927566659 2:24119404-24119426 CAGGGTGCAGCTGAGCCATGGGG - Intronic
929825595 2:45307133-45307155 CAGGGCCACACTGACTCCTGTGG + Intergenic
930106898 2:47647416-47647438 CAGGAGGACACTTAGCCCTGTGG - Intergenic
930995747 2:57715601-57715623 CAGGTGGCCTCTGAGACCTGTGG + Intergenic
932819073 2:74884360-74884382 CTGGGGGCCACAGAGCCCTGGGG - Intronic
933686362 2:85144801-85144823 GAGGGAGCCACTGTGCCCGGTGG - Intronic
934487960 2:94735701-94735723 CAGGAAGCCACTGCGGCCTGAGG + Intergenic
934897751 2:98133196-98133218 CAGGCCCCCACCCAGCCCTGTGG - Intronic
935237408 2:101150792-101150814 CAGGGCGGCCCCGAGCCCTCCGG + Intronic
941658242 2:168167608-168167630 CAGGAGACCACAGAGCCCTGTGG + Intronic
942080209 2:172393257-172393279 CAGGGCCCCACTCAGCCTTCTGG + Intergenic
942462491 2:176178056-176178078 CAGGGCGCCCCGGGCCCCTGCGG + Intergenic
943443228 2:187951630-187951652 CAGCCCGCCACTGAGCTGTGGGG + Intergenic
946325795 2:218984240-218984262 CTGGGGGCCGCTGAGCCCCGCGG - Exonic
947243287 2:228019246-228019268 CAGTGCACCACTGCTCCCTGGGG + Exonic
947367559 2:229412791-229412813 CTTTGCCCCACTGAGCCCTGGGG - Intronic
948454594 2:238098945-238098967 CTGGGGGCCACTGTGCACTGAGG - Exonic
948505122 2:238423156-238423178 CAGGGGCTCACTGAGCGCTGTGG + Intergenic
948800237 2:240430100-240430122 AAGGGAGCCCCTGAGGCCTGTGG - Intergenic
948853282 2:240718639-240718661 GAGGGCTCCTCTGAGCCCTGTGG + Intronic
1170743131 20:19075317-19075339 CAAGGTGCCACTCAGCCCTGAGG - Intergenic
1170982558 20:21228427-21228449 CAGGCTGCCACTGATCCCTGTGG + Intronic
1171360441 20:24583067-24583089 CAGGGCTGCAGTGAGACCTGAGG - Intronic
1172314600 20:33943975-33943997 CATGGGGCCCCTGAGGCCTGGGG - Intergenic
1173066767 20:39720830-39720852 CAGGCTGCCACTGAGCAATGAGG - Intergenic
1175203302 20:57292428-57292450 CAGGGGCCCACTGAGCCCTGGGG - Intergenic
1175514947 20:59563354-59563376 CTGGGTCCCAGTGAGCCCTGAGG - Intergenic
1175757506 20:61538914-61538936 CAGGAAGCCACGGTGCCCTGGGG - Intronic
1175863866 20:62164204-62164226 CAGGGCGCCGCGGAGCCCATGGG + Exonic
1175878802 20:62244448-62244470 CAGGGCGCCCGTGAGCTGTGGGG + Intronic
1175899330 20:62353842-62353864 CAGGGGCCCACTGAGCCCCCAGG + Intronic
1175909167 20:62396459-62396481 CGGGCTGCCACTGACCCCTGCGG - Intronic
1175924162 20:62463810-62463832 CAGGCAGCCACAGGGCCCTGCGG - Exonic
1176080729 20:63272138-63272160 CAGGGCGCACCTGCGCTCTGGGG + Intronic
1176171984 20:63700186-63700208 AAGGCCGCCGCTGCGCCCTGTGG + Exonic
1176289604 21:5037123-5037145 CAAGGTTCCCCTGAGCCCTGGGG - Intronic
1176382367 21:6119807-6119829 CGGGGTGCCACTGAGCCCCGCGG - Exonic
1177669714 21:24209112-24209134 CAGCCCGCCACTGAGCTGTGGGG - Intergenic
1178310518 21:31526167-31526189 CATAGCAGCACTGAGCCCTGGGG + Intronic
1178311167 21:31531210-31531232 CAGGCCTCCACTGAGCCCGTGGG + Intronic
1178638080 21:34322660-34322682 CAGGGCTCCCCTGGGCCCTCTGG + Intergenic
1179741105 21:43418432-43418454 CGGGGTGCCACTGAGCCCCGCGG + Exonic
1179867626 21:44226464-44226486 CAAGGTTCCCCTGAGCCCTGGGG + Intronic
1180699590 22:17774207-17774229 CAGGTCGCTGCTGAGGCCTGGGG + Intronic
1181061424 22:20283846-20283868 CAGGGAGCCAATTATCCCTGAGG + Intergenic
1181103049 22:20554380-20554402 GAGGGCTCCACAGAGCACTGAGG - Intronic
1182097760 22:27637538-27637560 CTGGGCCTCCCTGAGCCCTGGGG + Intergenic
1182351814 22:29703864-29703886 CACGGGGCCCCTGAGCCCAGTGG - Intergenic
1183260283 22:36790367-36790389 CAGGGCAGCAATGTGCCCTGTGG - Intergenic
1183716430 22:39535943-39535965 CAGGGGGCCACTGGTCCCTGGGG - Intergenic
1183831471 22:40420478-40420500 TCGGGCGCCCCTGGGCCCTGTGG - Exonic
1184060300 22:42077473-42077495 CCGGGCCCCACTGAGCCTGGTGG + Exonic
1184390616 22:44201187-44201209 CAGGGCCCCACAGAGCGCCGAGG - Intronic
1185092118 22:48781540-48781562 CAGGGCCGCTCTGAGCTCTGGGG + Intronic
1185168403 22:49276554-49276576 CAGAGCGGCACTGAGCCGGGGGG + Intergenic
950149587 3:10676320-10676342 TGGGGTGCCACTGAGCCTTGAGG + Intronic
950188414 3:10959735-10959757 CGGGGCCCCAGTGAGCTCTGTGG - Intergenic
950652621 3:14416671-14416693 CAGGGCGTCCCTGTGCCCTCTGG - Intronic
954143198 3:48620999-48621021 CAGGTGACCACTGAGCCCTGCGG - Exonic
954255217 3:49400434-49400456 CAGGAAGCCACTGAGGCCTCTGG - Intronic
954298297 3:49686142-49686164 CAGGGCGCCTCTGAGCCGTCGGG + Exonic
954381481 3:50221313-50221335 CTGGGGGCAGCTGAGCCCTGAGG + Intergenic
954689606 3:52388673-52388695 CAGGGCGCCGGTGGGTCCTGGGG + Intronic
955954059 3:64270079-64270101 CAGGGCCACATTGAGCCATGAGG + Intronic
956121604 3:65971630-65971652 CAGGGCTCCTGTGAGCCCTCAGG - Intronic
956889093 3:73592617-73592639 GAGGTCTCCACTGAGCACTGTGG + Intronic
961602535 3:128072604-128072626 CAGGGCCTCCCTGAGCCCTGAGG - Intronic
961652089 3:128421735-128421757 CAGGGGGCCCCTCAGTCCTGTGG - Intergenic
962388034 3:134948772-134948794 CAAGGAGTCAGTGAGCCCTGAGG - Intronic
962891836 3:139678794-139678816 CAAGGCTCCCATGAGCCCTGGGG - Intergenic
966918406 3:184597324-184597346 CTGGGCTCCTCAGAGCCCTGGGG - Intronic
968607678 4:1543150-1543172 CAGGGCACCCGTGAGCCATGGGG + Intergenic
968762667 4:2450651-2450673 GAGAGGGCCACTGAGCCCTGAGG + Intronic
969253790 4:5989296-5989318 CAGGGGCCTGCTGAGCCCTGGGG - Exonic
969313837 4:6369888-6369910 CAGGCCCACACTGAGCCCTAGGG - Intronic
969615502 4:8250392-8250414 CAGGGTGCCTCCCAGCCCTGTGG - Intergenic
969685024 4:8666752-8666774 GAGGGAGACAGTGAGCCCTGAGG + Intergenic
976077912 4:81320470-81320492 CTGGGCCCCACTCTGCCCTGTGG + Intergenic
980729960 4:136812211-136812233 CAGGCCGCCACTGAGCACTGGGG - Intergenic
982061051 4:151604372-151604394 CAGTGCACCAAGGAGCCCTGGGG + Intronic
982436027 4:155383938-155383960 CAGGGCTCCACAGGGTCCTGTGG + Intergenic
984862773 4:184254969-184254991 CTGGGCGCCACGGAGTCCAGAGG + Intergenic
985111235 4:186547558-186547580 CAGGAGGCAACGGAGCCCTGAGG - Intronic
985423337 4:189805636-189805658 CAAGGTGCCACGGAGCACTGCGG + Intergenic
985583795 5:715843-715865 CTGGGTGCCATAGAGCCCTGAGG - Intronic
985597301 5:800141-800163 CTGGGTGCCATAGAGCCCTGAGG - Intronic
985630445 5:1011288-1011310 GAGGGCGCACCTGGGCCCTGGGG - Intronic
985688256 5:1293573-1293595 GGGGCCGCCACAGAGCCCTGGGG + Exonic
986256892 5:6108277-6108299 CAGGGCTTCAGTGACCCCTGGGG + Intergenic
992835709 5:80639355-80639377 CTGGGCCACACTGAGGCCTGCGG + Intronic
997309219 5:132866218-132866240 CAGAGCGCCTCTGAGCCCCGAGG - Intronic
997382959 5:133450467-133450489 CAGAGCTCCCCTGGGCCCTGTGG - Intronic
997594389 5:135096328-135096350 GTGGCCTCCACTGAGCCCTGGGG - Intronic
997778204 5:136630216-136630238 CAGCGCTCCAGTGAGCCCTGGGG + Intergenic
997822493 5:137078567-137078589 CAGGGCGCCACTGCTTACTGGGG + Intronic
998156371 5:139789051-139789073 CAGGGAGCCACGGAGGCCTGGGG - Intergenic
999322084 5:150621768-150621790 CAGGGCAACACAGGGCCCTGTGG + Intronic
999575614 5:152973216-152973238 CAAGGAGCCCCTCAGCCCTGTGG + Intergenic
999604294 5:153297483-153297505 CTGGGCACCATTGAGCACTGAGG + Intergenic
1000552120 5:162679938-162679960 GAGGGAGCCACAGAGCCCTGTGG - Intergenic
1001108830 5:168878387-168878409 CAGGCGGCCTCTGAGCCCTGTGG - Intronic
1001756583 5:174175032-174175054 CAGTAAGCCACTGAGACCTGGGG - Intronic
1002689562 5:181040853-181040875 CAAGGCCCCACTGACACCTGCGG + Intronic
1002867153 6:1131537-1131559 AAGAGAGACACTGAGCCCTGGGG - Intergenic
1004510915 6:16284087-16284109 CAGAGGGCCACAGAGCACTGAGG - Intronic
1006055014 6:31377757-31377779 CAGGGAGCAACTCAGCCCTGCGG - Intergenic
1006189170 6:32197082-32197104 CAGAGGGCCAGTGACCCCTGGGG + Intronic
1006436339 6:34027786-34027808 CAGGGGGCGCCTGGGCCCTGAGG - Intronic
1015518353 6:134107314-134107336 CAGGGCGATACTTAGCTCTGAGG + Intergenic
1018172828 6:161155154-161155176 GAGGGCCACACCGAGCCCTGGGG - Intronic
1019324084 7:429524-429546 CTGGGATCCGCTGAGCCCTGGGG + Intergenic
1020101681 7:5397432-5397454 TTGGGTGCCATTGAGCCCTGTGG - Intronic
1020224199 7:6267006-6267028 AAGGGCAGCACTGAGCCATGAGG - Intronic
1020533480 7:9364249-9364271 CAGGGGGCCAATGAGTCCTCAGG + Intergenic
1022981160 7:35606099-35606121 CTGGGCTCTACAGAGCCCTGGGG + Intergenic
1023019271 7:35995662-35995684 CAGGGAGCCACTGACCCCTGGGG - Intergenic
1024423732 7:49201535-49201557 AAGTGAGCCACTGAGCCCTCTGG + Intergenic
1027183062 7:75953020-75953042 CTGGGCACCATTGAGCACTGAGG + Intronic
1028718720 7:94004389-94004411 CAGGGCTCCAATGAGCGCCGTGG - Intergenic
1031482978 7:122300449-122300471 CACGGGGCCCCTGAGGCCTGCGG + Intergenic
1034031777 7:147774620-147774642 CAGGGAGCCAGTGAGCTCTCCGG - Intronic
1035311589 7:157973070-157973092 CAGGGCCCCACTGAAGCCAGGGG + Intronic
1035382236 7:158447501-158447523 CAGGGCCCCAGGGAGCCCGGTGG + Intronic
1035643519 8:1201137-1201159 GAGGATGCCACGGAGCCCTGTGG + Intergenic
1036694902 8:10968003-10968025 CAGGTGGCCCCTGAGCCCGGAGG - Intronic
1036766779 8:11554482-11554504 CAGGGAATCACAGAGCCCTGCGG - Intronic
1037329977 8:17734852-17734874 CAGAGCTCCACTGAGCAATGAGG + Intronic
1037734085 8:21553177-21553199 CCGGGTTCCACTGAGACCTGGGG - Intergenic
1040029552 8:42812291-42812313 CAGTGCTCCCCTGAGCTCTGTGG - Intergenic
1040386707 8:46919123-46919145 GAGGGCGCCACTGTCCCCTCTGG + Intergenic
1044507510 8:93038906-93038928 CTGGGCACCATTGAGCACTGAGG - Intergenic
1045547288 8:103140578-103140600 CGGGCCGTCACGGAGCCCTGAGG + Intronic
1046672286 8:117069490-117069512 TTGGGGGCCACTGACCCCTGAGG - Intronic
1046973753 8:120250725-120250747 CAGGGCGTCGCTGAAGCCTGAGG - Exonic
1047511312 8:125517885-125517907 CAGGGCTGTAGTGAGCCCTGGGG + Intergenic
1048997302 8:139801920-139801942 CAGGGAGTCTCTGAGGCCTGTGG + Intronic
1049216667 8:141411448-141411470 CACGGCGCCACTGAGGCCCAGGG - Intronic
1049655248 8:143794317-143794339 CAGGGCGCCACTGAGCCCTGAGG - Intronic
1049905790 9:215139-215161 CGGGGCGCGCCTGAGACCTGGGG + Exonic
1050259406 9:3825818-3825840 CAGGGCTGCACTGGGTCCTGTGG + Intronic
1051633875 9:19164357-19164379 CAAAGGGACACTGAGCCCTGTGG - Intergenic
1052323242 9:27190847-27190869 CAGGGGGCCCCTGAGCTCTGGGG + Intronic
1053669839 9:40348718-40348740 CAGGAAGCCACTGCGGCCTGCGG - Intergenic
1054514773 9:66027578-66027600 CAGGAAGCCACTGCGGCCTGCGG + Intergenic
1055336659 9:75238798-75238820 CAGGGTGCCACACAGACCTGTGG - Intergenic
1056676899 9:88683487-88683509 CAGAGCACCACTGACTCCTGGGG - Intergenic
1056824673 9:89868637-89868659 CAGGGCGACTCTGAGCCAGGTGG - Intergenic
1057482464 9:95456141-95456163 TAGGGGGCCCCTGTGCCCTGAGG + Intronic
1058510537 9:105712896-105712918 CAGGTCGCCCCTGAGCTTTGGGG + Intronic
1059227998 9:112690887-112690909 GAGGGAGCCACTGACCCATGGGG + Intronic
1059405054 9:114094249-114094271 CCGGGCTCCACTGAGCCCTGAGG + Exonic
1060230138 9:121820006-121820028 CAGGGAGGCTCTGTGCCCTGCGG + Intergenic
1060434458 9:123581699-123581721 CAGGGTGCCACTGGGCCTTCTGG + Intronic
1060553415 9:124496354-124496376 CAGGGCGACAAGGAGGCCTGAGG - Intronic
1061127336 9:128685107-128685129 CAGGTCCACACTGAGCCCTGAGG - Intronic
1061134219 9:128724063-128724085 CTGGGCGCTCCTCAGCCCTGGGG - Exonic
1061289500 9:129642479-129642501 CTGGGCGCCCCTGAGAGCTGTGG + Intergenic
1061891401 9:133622820-133622842 CAGGGAGCCTCTGAGCCCTTAGG - Intergenic
1062164535 9:135100747-135100769 CAGGGAGTCCCTGAGCTCTGGGG + Intronic
1062342645 9:136100584-136100606 CAGGGGGCCCCAGAGCCCAGGGG + Intergenic
1062566838 9:137167328-137167350 CAGGGCGGCACTGGGCGCTGAGG + Intronic
1186565626 X:10659208-10659230 CAGGGAGCCACAGACCCCAGGGG - Intronic
1190457190 X:50637814-50637836 CAGGCCAGAACTGAGCCCTGGGG + Intronic
1198263796 X:134990940-134990962 CAGGGCGCCAGTGACCGCTGGGG + Exonic