ID: 1049655249

View in Genome Browser
Species Human (GRCh38)
Location 8:143794335-143794357
Sequence AGTCATGGGGGCAGCAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 252}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049655249_1049655255 -5 Left 1049655249 8:143794335-143794357 CCCTGACTGCTGCCCCCATGACT 0: 1
1: 0
2: 1
3: 23
4: 252
Right 1049655255 8:143794353-143794375 TGACTGTGCTGTTGTTCATGAGG No data
1049655249_1049655258 11 Left 1049655249 8:143794335-143794357 CCCTGACTGCTGCCCCCATGACT 0: 1
1: 0
2: 1
3: 23
4: 252
Right 1049655258 8:143794369-143794391 CATGAGGATGAAGGGCCTCCCGG No data
1049655249_1049655257 3 Left 1049655249 8:143794335-143794357 CCCTGACTGCTGCCCCCATGACT 0: 1
1: 0
2: 1
3: 23
4: 252
Right 1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG No data
1049655249_1049655260 26 Left 1049655249 8:143794335-143794357 CCCTGACTGCTGCCCCCATGACT 0: 1
1: 0
2: 1
3: 23
4: 252
Right 1049655260 8:143794384-143794406 CCTCCCGGAAGCCTCCCTCTTGG No data
1049655249_1049655256 2 Left 1049655249 8:143794335-143794357 CCCTGACTGCTGCCCCCATGACT 0: 1
1: 0
2: 1
3: 23
4: 252
Right 1049655256 8:143794360-143794382 GCTGTTGTTCATGAGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049655249 Original CRISPR AGTCATGGGGGCAGCAGTCA GGG (reversed) Intronic
902154211 1:14470792-14470814 AGTCATGGGAGCAGGGGTCTTGG - Intergenic
902188393 1:14742794-14742816 AGCCATGGTGGCAGGAGCCAGGG + Intronic
903459194 1:23508985-23509007 GAGCATGGGGGCAGCTGTCATGG - Exonic
904965824 1:34371839-34371861 AGTAATGGAGGCAGCAGTTTGGG - Intergenic
906066771 1:42986334-42986356 AGTGATGGGGCCTTCAGTCAGGG + Intergenic
906291405 1:44621948-44621970 CGTAGTGGGGGCAGCAGGCAGGG + Intronic
907317142 1:53579702-53579724 AGCCATGGGGGCAGCCGTGGGGG + Intronic
907466673 1:54642299-54642321 AGTCATGAGGGCATCTGTCCAGG + Intronic
907490406 1:54805690-54805712 AGTCAGGGGAGCAGAAGTAAGGG - Intergenic
907581387 1:55575612-55575634 AGTCATGGGGGCAGGTGTCCTGG + Intergenic
907830043 1:58056327-58056349 AGTGAAGGCCGCAGCAGTCAGGG - Intronic
909481685 1:76133408-76133430 AGTAAAGTGGCCAGCAGTCAAGG + Intronic
909673293 1:78212269-78212291 AGTGTTGGGGCCAGCAGTCCAGG + Intergenic
910268371 1:85365728-85365750 CATCAAGGGGGCAGCAATCATGG - Intronic
911924822 1:103816865-103816887 AGTCAAAGGGGCAGCATCCATGG - Intergenic
912430989 1:109628313-109628335 AGTCAGGGGACCAGGAGTCACGG + Intronic
913022051 1:114798079-114798101 GGTCATGGGGGTAGCTGGCAAGG - Intergenic
913121297 1:115743299-115743321 AATCATGCAGGCAGAAGTCACGG + Intronic
914312790 1:146482199-146482221 AGACATCTGGGCAGCAGTGAGGG + Intergenic
914501558 1:148251174-148251196 AGACATCTGGGCAGCAGTGAGGG - Intergenic
915461489 1:156073156-156073178 AGGCCTGGGGGAAGCAGGCATGG + Exonic
915580630 1:156810929-156810951 AGGCATGGGGACAGCATTCATGG - Intronic
915894352 1:159799991-159800013 TGTCAGGGCGGCAGTAGTCAGGG - Intergenic
916075230 1:161196760-161196782 AGTGATGGCAGCAGCAGCCAAGG - Exonic
916278675 1:163023999-163024021 AGTCATCAGGCCAGCACTCATGG - Intergenic
916295310 1:163212677-163212699 AGTCAAGGGGACAGCTGTCCTGG + Intronic
916853436 1:168726792-168726814 AGTCATGGAGACAACAATCAAGG + Intronic
922227690 1:223659809-223659831 AGTCTTGGGGTCATTAGTCATGG + Intronic
923235416 1:232028328-232028350 AGTTCTGAGGGCTGCAGTCAGGG + Intronic
924939972 1:248806354-248806376 ACTAATGAGGGCTGCAGTCAAGG - Intergenic
1064273942 10:13890254-13890276 TGCATTGGGGGCAGCAGTCAGGG - Intronic
1065338597 10:24680786-24680808 AGTGAAGGAGCCAGCAGTCATGG + Intronic
1066616862 10:37303714-37303736 AGCTATGGTGACAGCAGTCAGGG + Intronic
1067192477 10:44082970-44082992 AGGCATGGGGCCAGCAGAGATGG - Intergenic
1067939934 10:50646821-50646843 AATCCTGGGGTCAGCAGTCTTGG - Intergenic
1070409671 10:76128313-76128335 AGCCATGGGGGCAGCACAGATGG + Intronic
1070984986 10:80680973-80680995 AGTCTGTGGGGCAGGAGTCAAGG + Intergenic
1071166670 10:82815818-82815840 AGCCAGGGGTGCAGCAGTGAGGG + Intronic
1072887926 10:99296798-99296820 AGTCAGTAGGGCAGTAGTCAAGG + Intergenic
1073831966 10:107394828-107394850 AGTCATGGTGGCAGTAGTGGTGG + Intergenic
1074189016 10:111119839-111119861 AGCCATGGGAGCAGCAGGCATGG - Intergenic
1075480415 10:122776743-122776765 AGTCAAGAGGGCAGCATTCTGGG - Intergenic
1075541664 10:123318842-123318864 AGTAATGGTGGCAGCAGTGAGGG + Intergenic
1076712501 10:132346147-132346169 GCTCATGGGGGCAGCAGCCTCGG + Intronic
1077160096 11:1108738-1108760 AGTCCTGGGCGCAGCTGTGATGG + Intergenic
1079371685 11:19859075-19859097 AGTCTTGTGGGCATCTGTCAGGG + Intronic
1080765943 11:35296799-35296821 AGTGATGGGGGTAGAAGTGATGG - Intronic
1084591528 11:70093351-70093373 AGCCATGGGGTCAGCTTTCAGGG + Intronic
1085360436 11:75880512-75880534 AGTCATGGGTACAGCAGAGATGG - Intronic
1090459962 11:126882134-126882156 AGTCAAGAGGGCAGGAGTCAGGG - Intronic
1091785242 12:3239326-3239348 AGTCAGGGAGGCAGCATTCACGG - Intronic
1091800817 12:3323491-3323513 GGTCAGGGGGGCAGCTGTCCTGG - Intergenic
1092957062 12:13560808-13560830 AGGGTTGGGGACAGCAGTCAAGG + Exonic
1092979677 12:13781826-13781848 AGTCACGGGGTCAGCTGTCAGGG + Intronic
1093484251 12:19636477-19636499 AGTTATGGGCTCAGCTGTCAGGG + Intronic
1098156620 12:67606154-67606176 AGTGCTGGGAGCAGCAGTGAGGG - Intergenic
1100684382 12:96970759-96970781 TGTCATGGAGGCAGCAGAGAGGG + Intergenic
1102525773 12:113511599-113511621 AGTTAGGGGGGCTGCAGGCAGGG + Intergenic
1103913681 12:124365178-124365200 AGGCGTGAGGGCAGCAGCCACGG + Intronic
1104156940 12:126142464-126142486 AGGCATGGGGGCTGCTGTCTCGG - Intergenic
1105826274 13:24126198-24126220 AGTCATGGGGGCAGGAGCCATGG + Intronic
1106735090 13:32580918-32580940 GGTCTTGGGGGCAGCAGGGAAGG - Intergenic
1107401924 13:40077681-40077703 GGTCATGTGGGCAGCAGGGATGG - Intergenic
1108080385 13:46728882-46728904 AGACCTGGGGGCAGCCCTCATGG + Exonic
1109466093 13:62733467-62733489 AGACCTGGAGGCAGCATTCATGG + Intergenic
1110369628 13:74725432-74725454 AGTAATAGGGGCAACAATCAAGG + Intergenic
1110760227 13:79223061-79223083 AGTCATGCAGGCACAAGTCAAGG + Intergenic
1112342738 13:98565993-98566015 AGGCATGGGGGTGGCAGCCAAGG + Intronic
1114171481 14:20277221-20277243 AGTCATGAAGACAGCTGTCAGGG - Intronic
1114431814 14:22667858-22667880 AGTCATGGTGGCAGATGACAGGG + Intergenic
1114549202 14:23523526-23523548 AGCACTGGGGGCAGCAGTGAGGG - Exonic
1119893617 14:78201520-78201542 AGGCATGGGGGCAGTGGTGAAGG + Intergenic
1120032720 14:79660847-79660869 AGTAATGGTGTCTGCAGTCATGG + Intronic
1121742343 14:96263059-96263081 AGACATGGAGGCAGAGGTCATGG - Intronic
1122983479 14:105201875-105201897 AGTCCTGGGGGCATCAGTGATGG + Intergenic
1124112067 15:26799713-26799735 AATCCTGGGGGCTGCAGTCTTGG - Intronic
1125433938 15:39626028-39626050 TGTGATGGGGTCAGTAGTCAAGG + Intronic
1125437304 15:39660251-39660273 AGGCATGGGGACAGAACTCAAGG - Intronic
1126685255 15:51242832-51242854 TGGCATGGTGGCAGCAGGCATGG + Exonic
1129245577 15:74276860-74276882 AGGAATGGGGTCAGAAGTCATGG + Intronic
1130093834 15:80841496-80841518 AGACATGGGGGAAGCGGGCAAGG + Intronic
1131118420 15:89808411-89808433 TGTCATGGGGCCTGCAGTCCAGG - Intronic
1132950252 16:2557799-2557821 ATTCCTGGTGGCAGCAGGCAGGG + Exonic
1132964094 16:2642371-2642393 ATTCCTGGTGGCAGCAGGCAGGG - Intergenic
1134786939 16:16953104-16953126 AGCCATTGGGCCAGCAGCCATGG + Intergenic
1135173322 16:20206188-20206210 AGTAATGGAGGCAGAGGTCATGG - Intergenic
1136274120 16:29168145-29168167 AGCCAAGGGTGCAGCACTCAAGG + Intergenic
1136665658 16:31810210-31810232 AGTCAGGGGAGGAGCGGTCAAGG - Intergenic
1137747927 16:50836823-50836845 AGACATGTGGGCAGGAGCCATGG - Intergenic
1137929803 16:52576146-52576168 ATGCATGGGGGCAACAGTGAGGG - Intergenic
1138503008 16:57460083-57460105 ACTCATGGGTGCAGCAGTGACGG + Exonic
1139366803 16:66438676-66438698 AGTCGAGGGGGCTGCAGTCTTGG - Intronic
1140634679 16:76898259-76898281 AGTCATGTGGGCAGTTTTCAAGG + Intergenic
1140718567 16:77749520-77749542 AGTCATGGGGGCAACTGTGGTGG - Intergenic
1140816391 16:78624992-78625014 AGTGATGGAGGCAGAACTCAGGG - Intronic
1142077774 16:88130412-88130434 AGCCAAGGGTGCAGCACTCAAGG + Intergenic
1142191667 16:88720975-88720997 ATCCCCGGGGGCAGCAGTCAGGG + Intronic
1144662923 17:17082974-17082996 AGGCTTGGGGTCAGCAGACATGG - Intronic
1145875834 17:28317923-28317945 TGTCGTGGGGGCAGGAGCCAGGG - Intergenic
1147993897 17:44351057-44351079 TGTCTTGGGGGCAGCAGTGCAGG - Exonic
1147994123 17:44352035-44352057 AGCCCTGGGGGCAGCAGTGCTGG - Exonic
1148028595 17:44605035-44605057 AGGCCTGGGAGGAGCAGTCATGG - Intergenic
1148212016 17:45814328-45814350 AGTTAAGGGGGCAGCAGGAAGGG - Intronic
1149578359 17:57729654-57729676 AGTCATGGAGGTTGCAGACAAGG - Intergenic
1149666139 17:58365857-58365879 AGCCCTAGGGGCAGCAGGCAAGG + Intronic
1149701862 17:58661944-58661966 AGTACAGGGGGCAGCAGTCGAGG - Intronic
1150634603 17:66904053-66904075 GCTCCTGGGGGCAGCAGTGAGGG + Intergenic
1150700274 17:67441017-67441039 AGTCTTGGGTGCATCTGTCAGGG + Intronic
1152863439 17:82709166-82709188 TGGCATGGGGGCAGGAGACAGGG - Intergenic
1152961964 18:85530-85552 ACTCCTGGGAGCAGCAGTCCAGG - Intergenic
1153104369 18:1510577-1510599 AGTAGTGGCAGCAGCAGTCAGGG + Intergenic
1153880360 18:9417090-9417112 TGTGATGGGGGCAGGAGGCACGG - Intergenic
1154009761 18:10564695-10564717 GGTCTTGGGGGCAGCACTGAAGG + Intergenic
1155635065 18:27942905-27942927 AGTCTTGGTGCAAGCAGTCAAGG + Intergenic
1155741756 18:29297863-29297885 ATTCATGGGTCCAGGAGTCAAGG - Intergenic
1156125422 18:33899219-33899241 AGACATGTGGGCACCAGTGAGGG - Intronic
1156483088 18:37448402-37448424 TGTCAGTGGGGCTGCAGTCAGGG - Intronic
1157579979 18:48768363-48768385 AGGCATGGAGCCATCAGTCATGG + Intronic
1157780120 18:50430854-50430876 AGTGATGGGGGAGGCAGGCAGGG + Intergenic
1160387643 18:78506135-78506157 GGTCATGGGGGCAGCAGCGAGGG - Intergenic
1160862868 19:1245059-1245081 AGTGATGGGGACATCGGTCAGGG + Intergenic
1164437121 19:28240285-28240307 ATTCTTGGGGGCAGCAGGGAAGG + Intergenic
1164843909 19:31415826-31415848 AGTGAGGGGAGCCGCAGTCAGGG + Intergenic
1164953060 19:32355158-32355180 TGTCAAGGAGGCAGCAGGCAGGG - Intronic
1166084299 19:40464989-40465011 AGACTTGGGGACAGCAGTCCTGG - Intronic
1166270398 19:41710038-41710060 GGTCATGGGGGAATCACTCACGG - Exonic
1166764263 19:45243551-45243573 AGCCATGGGGGCTCCAGGCAAGG - Intronic
1168712838 19:58511705-58511727 AGTCCTGGGGGCAGCCGTGCTGG + Exonic
929189856 2:39129876-39129898 ATTCATGGGTCCAGCAATCAAGG + Intergenic
931252869 2:60549657-60549679 GGGCATGGAGGCAGCAGTCAGGG - Intronic
931851124 2:66251607-66251629 AGTCATGGGGGCCCCAGTAGGGG + Intergenic
933565414 2:83944449-83944471 AGTAATGTGGGAAGCAGTGAGGG - Intergenic
934769851 2:96900704-96900726 AGGCCTGGGGGAAGCATTCAAGG + Intronic
934865104 2:97801481-97801503 AGTCATGGGTTTAGCATTCATGG + Intronic
935518646 2:104077623-104077645 AGTCAGGGGTGGAGCAGTGAGGG + Intergenic
935617436 2:105101148-105101170 GGTCCTGGGGGCCACAGTCAAGG - Intergenic
937349568 2:121152249-121152271 AGTCTCGGGGACAGCTGTCAGGG - Intergenic
938111429 2:128568772-128568794 TGTGATGGGGTCATCAGTCAAGG - Intergenic
938206967 2:129432132-129432154 ACTCATGGGGGCAGAAGTAGAGG - Intergenic
940521923 2:154762020-154762042 ATTAATGGGGCCAGTAGTCAAGG + Intronic
941783417 2:169473811-169473833 AGTCTAGGGGGCAGAAGGCAGGG + Intergenic
942222543 2:173784455-173784477 TGTCATGGGGGCAGCAGAGAGGG + Intergenic
946417418 2:219547345-219547367 AGTCATGACGGCATCAGTGATGG - Intronic
1173075223 20:39812054-39812076 TGTCATTGAGGCAGGAGTCAGGG + Intergenic
1173501928 20:43560063-43560085 AGGCATGGGGGTCACAGTCAAGG + Intronic
1173766534 20:45615366-45615388 AGTCAAGTGGGCAGGAGGCAGGG + Intronic
1173818297 20:46004319-46004341 GTCCATGGGGGCAGCAGTCTAGG - Intergenic
1174286058 20:49474402-49474424 AGTCATGGGCTGGGCAGTCAGGG + Intronic
1176134758 20:63517593-63517615 AGTCCGGGGGGCAGCAGCCAAGG - Intergenic
1178246798 21:30960789-30960811 AGTAATGTGGGCACAAGTCAAGG + Intergenic
1178379158 21:32093651-32093673 GGACATGGGGGCAGGAGTAATGG - Intergenic
1179218430 21:39386442-39386464 TCTCGTGGGGGCAGCAGCCAAGG + Intronic
1179715138 21:43282482-43282504 AGAGGTGGGGGCAGCAGGCAGGG + Intergenic
1180034878 21:45241458-45241480 AGTGGTGGTGGCAGCAGGCAGGG - Intergenic
1180060303 21:45381601-45381623 AGGCATGGGGGCCACAGCCAAGG + Intergenic
1183011754 22:34952468-34952490 AATCAAGGGGTCAGCAATCAAGG - Intergenic
1183020075 22:35019843-35019865 AGACATGGAGGCTGGAGTCAGGG - Intergenic
1183396546 22:37574727-37574749 AGTCAAGGGGGCAGTGGCCATGG + Intronic
1184043165 22:41956547-41956569 AGCCATGGCAGCTGCAGTCAGGG + Intergenic
1184515313 22:44958249-44958271 AGTCAGGGAGGCAGCAGGCCCGG - Intronic
1185269552 22:49922792-49922814 AGGCATGGGGGCGGGAGGCAGGG + Intronic
950294888 3:11820903-11820925 AGGCATGCAGCCAGCAGTCAGGG + Intronic
952314684 3:32222356-32222378 AGGCAAGGGGGCAGGAGGCAGGG - Intergenic
954147915 3:48643383-48643405 AGGCCTGGGGGCAGCAGCTAGGG + Intronic
954219503 3:49144350-49144372 AGCCAGGGAGGCAGTAGTCACGG + Intergenic
954397805 3:50302323-50302345 AGTCATAGTTGTAGCAGTCAGGG + Exonic
955368942 3:58333652-58333674 AGTGGTGGGGGCGGCAGTCGGGG + Intronic
955483753 3:59415148-59415170 AGTCATGAGGGCCTCACTCAGGG + Intergenic
955506186 3:59635371-59635393 AGTCATGAGACCAGCAGTCTTGG + Intergenic
957527614 3:81397434-81397456 AGTAATGGGGGCAGCAGTATTGG + Intergenic
957703664 3:83752104-83752126 ATTCATGGGTCCAGGAGTCAAGG + Intergenic
961119503 3:124361791-124361813 AGTGATGGTGGCAGCAGTGGGGG + Intronic
961119512 3:124361822-124361844 AGTGATGGTGGCAGCAGTGGGGG + Intronic
963383835 3:144565923-144565945 AGGCATGGGGGCAGGGGGCAAGG - Intergenic
967132680 3:186487123-186487145 AGACATGAGGGCCACAGTCATGG - Intergenic
967874526 3:194258060-194258082 AGTCATGGGAACAGTAGTCCTGG - Intergenic
968669982 4:1844057-1844079 AGGCATGATGCCAGCAGTCACGG + Intronic
969606104 4:8202999-8203021 AGCCATGGGGGCAGGGGTGATGG + Intronic
972642962 4:40942416-40942438 AGTCCTGGGGTCTGGAGTCAGGG + Intronic
974741895 4:66017903-66017925 AATCATGTGGGCATCATTCATGG - Intergenic
976190912 4:82485717-82485739 AGTCTGGGGAGAAGCAGTCAAGG + Exonic
976671822 4:87662370-87662392 AGTGATGGGGAGAGCAGCCATGG + Exonic
977546241 4:98382886-98382908 ATACATGGTGGCAGCAGTAAGGG + Intronic
981049161 4:140293830-140293852 ATTCATGGAGGCAGCCATCAAGG + Intronic
981873735 4:149516639-149516661 ATTCATGGGGCCAGGAATCAAGG + Intergenic
984311793 4:178070165-178070187 AGACAAGGGGGCAGAAGTAAAGG + Intergenic
985278261 4:188260073-188260095 ACCCCTGGAGGCAGCAGTCAGGG - Intergenic
1202764291 4_GL000008v2_random:137209-137231 AGTCATTAGGGCCCCAGTCAGGG - Intergenic
985668069 5:1192269-1192291 TGTCATGGGGGGAGATGTCATGG + Intergenic
985668096 5:1192358-1192380 TGTCATGGGGGGAGATGTCATGG + Intergenic
985668120 5:1192447-1192469 TGTCATGGGGGGAGATGTCATGG + Intergenic
990197764 5:53337824-53337846 AGGCATGGGGGCAGCAGCTGTGG - Intergenic
990250646 5:53911400-53911422 AGTCATGGGGGAAGGAATGAGGG - Intronic
990801517 5:59609529-59609551 AGTCATTGTGGCAGAAGACAGGG - Intronic
991191204 5:63876082-63876104 ATTCATGGGCGCAGCAGGCCGGG + Intergenic
992300535 5:75374594-75374616 AGTGAAGGTCGCAGCAGTCAGGG + Intronic
993940972 5:94058858-94058880 GGTCATGGGGGCAGAACTCATGG + Intronic
995661599 5:114489736-114489758 AGTCATAGGGGAAGCACACAGGG + Intronic
995811674 5:116114344-116114366 AGTAATGGTGGCAGCAGTAGTGG + Intronic
996001736 5:118372395-118372417 AGTCCTGGAGGCAGCAGGGAGGG - Intergenic
997512298 5:134462056-134462078 AGCACTGGGGGCAGCAGGCAAGG - Intergenic
999192086 5:149755977-149755999 AGGCACAGCGGCAGCAGTCAGGG + Intronic
1001173092 5:169440180-169440202 AGTCAAGGAGGCTGCAGTAATGG - Intergenic
1001444542 5:171773277-171773299 AGTCATGGTGGAAGGAATCATGG - Intergenic
1002051502 5:176574130-176574152 AGACATGGGGTCTGCAGGCATGG + Exonic
1002163900 5:177332911-177332933 AGTCGGGGGGGCCGCAGTCAGGG - Intronic
1004834427 6:19515237-19515259 AATCATGGTGGAAGCTGTCAAGG - Intergenic
1005499924 6:26420977-26420999 GGTCTTGGGGGAAGCAGGCATGG - Intergenic
1006116863 6:31780204-31780226 CCCCATGGGGGCAGGAGTCATGG + Intronic
1007807289 6:44459810-44459832 AGCCATGGGGGCAGCAGTGGTGG + Intergenic
1009907920 6:69891618-69891640 ACTCATGGCGGCAGCTGCCAAGG - Intronic
1010569849 6:77463559-77463581 GGTCATGGGTGCGGCAGCCAAGG + Intergenic
1010623145 6:78101590-78101612 AGTCATGGGGCCACTAGTTAAGG + Intergenic
1012293496 6:97490097-97490119 AGTCATTGGGGCAGAAATGAAGG - Intergenic
1012931733 6:105324288-105324310 ACTCATGTGGACAGCAATCACGG + Intronic
1014813149 6:125907363-125907385 AGCGATGGGGGAAGCATTCAGGG + Intronic
1016525830 6:145000528-145000550 AGTCATGGGACCAGAAGCCAAGG + Intergenic
1018864796 6:167737900-167737922 AATGAAGGGGGCAGCAGGCAGGG - Intergenic
1019277033 7:181317-181339 AGTTATGGGGGCTGCGGGCAGGG - Intergenic
1019715418 7:2536585-2536607 GGTCAGGGGGACAGAAGTCAAGG + Intergenic
1019741400 7:2676555-2676577 GGTCAAGGGGACAGAAGTCAGGG - Intergenic
1020088330 7:5323444-5323466 TGCCATGGGGGCAGCAGGGAAGG - Intronic
1020584903 7:10054154-10054176 AATCATGGGGGCAGTTTTCATGG + Intergenic
1023079409 7:36513486-36513508 AGACATGGGGGTGGGAGTCATGG - Intronic
1023913404 7:44570792-44570814 AGTCCTGGGGGCCCCAGTCAAGG - Exonic
1025984088 7:66432498-66432520 AGTGATTAGGGCTGCAGTCAAGG - Intergenic
1026135849 7:67660040-67660062 AGTGATGTGGGCATAAGTCAAGG + Intergenic
1027207248 7:76110822-76110844 AGTGATTAGGGCTGCAGTCAAGG - Intergenic
1027265604 7:76493707-76493729 AGACCTGGGGGCACCAGCCAAGG + Intronic
1027316975 7:76991824-76991846 AGACCTGGGGGCACCAGCCAAGG + Intergenic
1027358614 7:77384907-77384929 AGACATGGGGGCAGAAGGCAGGG + Intronic
1029504394 7:100953662-100953684 AGTGATGGGAGGAGAAGTCATGG - Exonic
1031993291 7:128211542-128211564 AGTTTTGGGGGCGGCAGGCAGGG + Intergenic
1032060136 7:128717188-128717210 TGTCATGTGGACAGGAGTCAGGG + Intronic
1032089324 7:128903438-128903460 AGACATGGGGTCAGCCCTCAGGG - Intronic
1033660204 7:143397491-143397513 GGTCGTTGGGGCTGCAGTCAGGG + Intronic
1034138079 7:148789948-148789970 AACCATGGGGGCAACACTCAGGG + Intronic
1034559349 7:151870212-151870234 ACTCATGGGGGCAGAAGAAATGG + Intronic
1034958373 7:155349991-155350013 TGTCCTGGGAGCAGCAGTCACGG - Intergenic
1036822096 8:11949577-11949599 AGACATGTGGTCAGAAGTCATGG + Intergenic
1044199629 8:89418429-89418451 AGTCATAGGGGCTGCAGTAAGGG + Intergenic
1045231445 8:100310311-100310333 AGGCGTGGGGGCCGCAGTCGGGG - Intronic
1046763368 8:118044311-118044333 AGCCATGGGGGCAGCAGTTCTGG - Intronic
1047372983 8:124271559-124271581 AGTCATCGGGGCTGCCGTGATGG - Intergenic
1048411356 8:134177405-134177427 AGTTCAGGGGGCAGCAGTTAGGG - Intergenic
1048491486 8:134897696-134897718 AGTCATGGTGGCAGGAATTATGG - Intergenic
1048828139 8:138449541-138449563 AGTCATGGGCCCACCACTCAAGG + Intronic
1049235234 8:141508820-141508842 AGGCCTTGGGGCAGCAGCCAGGG - Intergenic
1049393190 8:142382498-142382520 AGTCATGCGGGCAGGGGGCAGGG + Intronic
1049576304 8:143391531-143391553 ACTGATGGAGGCAGCTGTCAGGG - Intergenic
1049655249 8:143794335-143794357 AGTCATGGGGGCAGCAGTCAGGG - Intronic
1049767355 8:144361057-144361079 AGGCATGGTGGCAGCATTGAGGG - Exonic
1049859949 8:144891374-144891396 AGGGCTGGGGGCAGAAGTCAAGG + Intronic
1051766352 9:20528608-20528630 AGTGATGGGGCCACAAGTCAAGG - Intronic
1052578394 9:30320136-30320158 ATTCCTGGGGGCTGCAGTCATGG - Intergenic
1053416071 9:37947563-37947585 AGTCAGGAGGGCGGCAGGCATGG - Intronic
1053479147 9:38403084-38403106 AGTCCTGGTGGCTGCAGCCAGGG - Intergenic
1054098376 9:60921283-60921305 GGTCAGGGGGGCAGCCTTCATGG + Intergenic
1054119777 9:61196913-61196935 GGTCAGGGGGGCAGCCTTCATGG + Intergenic
1055656264 9:78453027-78453049 AGGGATGGGGGCAGGAGACAGGG - Intergenic
1056379832 9:86047174-86047196 AGTCATCAGGGCAGCAGGGATGG - Intronic
1057167721 9:92941743-92941765 AGCCATGAGGGCAGCTGACAAGG - Intergenic
1058600309 9:106661889-106661911 AGTCATAGGGGAAATAGTCAGGG + Intergenic
1058820233 9:108722867-108722889 TGGCATGGGGGCAGGAGGCACGG - Intergenic
1061727790 9:132590699-132590721 AGTGATGGGGGGAGCAGCCTCGG - Intergenic
1187497576 X:19808603-19808625 AGTCTTGAGGGCAGCAGTTGTGG - Intronic
1187573752 X:20532396-20532418 AGTTCTGGGGGCTGCAGGCAGGG - Intergenic
1190378818 X:49818117-49818139 GGTCCTGGGGGCTGCAGACATGG + Intergenic
1191882639 X:65857922-65857944 AAGGAAGGGGGCAGCAGTCAAGG - Intergenic
1192152969 X:68723586-68723608 GGGGATGGGGGCAGCTGTCAGGG - Intronic
1192312941 X:70031665-70031687 AGACATGGAGGTGGCAGTCAGGG - Intronic
1193573519 X:83173741-83173763 ATTCATGGGTCCAGGAGTCAAGG - Intergenic
1195011922 X:100741155-100741177 AGTTGTGGGGGCAACAGCCAAGG + Intergenic
1196078023 X:111598989-111599011 AGCCATGGAGGCAGCTGTCTTGG - Intergenic
1196189434 X:112779463-112779485 AGTGATGGCGGCAGCAGTGGCGG + Exonic
1198981577 X:142403573-142403595 AGTCCTGAAGGCAGCATTCATGG - Intergenic
1201479037 Y:14417410-14417432 AGAAATGGTGGGAGCAGTCAGGG + Intergenic