ID: 1049655250

View in Genome Browser
Species Human (GRCh38)
Location 8:143794336-143794358
Sequence CAGTCATGGGGGCAGCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 229}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049655250_1049655255 -6 Left 1049655250 8:143794336-143794358 CCTGACTGCTGCCCCCATGACTG 0: 1
1: 0
2: 0
3: 16
4: 229
Right 1049655255 8:143794353-143794375 TGACTGTGCTGTTGTTCATGAGG No data
1049655250_1049655257 2 Left 1049655250 8:143794336-143794358 CCTGACTGCTGCCCCCATGACTG 0: 1
1: 0
2: 0
3: 16
4: 229
Right 1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG No data
1049655250_1049655256 1 Left 1049655250 8:143794336-143794358 CCTGACTGCTGCCCCCATGACTG 0: 1
1: 0
2: 0
3: 16
4: 229
Right 1049655256 8:143794360-143794382 GCTGTTGTTCATGAGGATGAAGG No data
1049655250_1049655258 10 Left 1049655250 8:143794336-143794358 CCTGACTGCTGCCCCCATGACTG 0: 1
1: 0
2: 0
3: 16
4: 229
Right 1049655258 8:143794369-143794391 CATGAGGATGAAGGGCCTCCCGG No data
1049655250_1049655260 25 Left 1049655250 8:143794336-143794358 CCTGACTGCTGCCCCCATGACTG 0: 1
1: 0
2: 0
3: 16
4: 229
Right 1049655260 8:143794384-143794406 CCTCCCGGAAGCCTCCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049655250 Original CRISPR CAGTCATGGGGGCAGCAGTC AGG (reversed) Intronic
900120402 1:1046419-1046441 CAGTCACGGAGGCAGATGTCGGG - Exonic
900534465 1:3170227-3170249 CACTCCTGGGGGAAGCAGCCAGG - Intronic
900695842 1:4009882-4009904 CAGGCATGGGGGCAGAAGCTTGG + Intergenic
901446788 1:9313499-9313521 AGGTCATGTGGGCAGCAGTTCGG - Intronic
902188392 1:14742793-14742815 CAGCCATGGTGGCAGGAGCCAGG + Intronic
904300245 1:29549483-29549505 CAGGCCTGGGAGCAGCAGTGGGG - Intergenic
904312959 1:29641254-29641276 CAGGGATGGGGGCAGCAGTGAGG - Intergenic
904457990 1:30658632-30658654 CAGGCCTGGGAGCAGCAGTGGGG + Intergenic
904965825 1:34371840-34371862 GAGTAATGGAGGCAGCAGTTTGG - Intergenic
906535215 1:46547668-46547690 CTGACATAGGGGCAGCAGGCAGG + Exonic
906706916 1:47901685-47901707 CAGCCATGGGGGCAGACTTCTGG + Intronic
907249375 1:53127953-53127975 CAGTCCCTGGGCCAGCAGTCTGG - Intronic
907317141 1:53579701-53579723 CAGCCATGGGGGCAGCCGTGGGG + Intronic
910264832 1:85327554-85327576 CATTCAAGGAGGTAGCAGTCTGG - Intronic
914245747 1:145884909-145884931 CAGTCCTCTGGGGAGCAGTCAGG + Intronic
914312789 1:146482198-146482220 CAGACATCTGGGCAGCAGTGAGG + Intergenic
914501559 1:148251175-148251197 CAGACATCTGGGCAGCAGTGAGG - Intergenic
915095471 1:153459431-153459453 CAGTCATGGGGGCAGGACAATGG + Intronic
921117517 1:212107658-212107680 CAGAGCTGGGGGCAGCAGTCAGG - Intergenic
923235415 1:232028327-232028349 CAGTTCTGAGGGCTGCAGTCAGG + Intronic
1063415286 10:5868252-5868274 CAGTCAAAGGGCCAGCAGTTTGG - Intronic
1068253027 10:54469382-54469404 CAGGGATGGGGGCAGCATGCTGG - Intronic
1071572875 10:86707741-86707763 CCGGGATGGGGGCAGCAGACAGG - Intronic
1075480416 10:122776744-122776766 AAGTCAAGAGGGCAGCATTCTGG - Intergenic
1075541663 10:123318841-123318863 AAGTAATGGTGGCAGCAGTGAGG + Intergenic
1076387164 10:130065514-130065536 CAGGGATGGGAGCAGCTGTCTGG + Intergenic
1076713957 10:132353975-132353997 GAGTCAAGGGGGCAGGTGTCTGG - Intronic
1080412365 11:32037885-32037907 CAGAAATGGGAGCAGCTGTCAGG - Intronic
1081773596 11:45664146-45664168 CAGGCTTGGGCGCAGGAGTCAGG - Intronic
1084329337 11:68421391-68421413 CAGACTTTGGGACAGCAGTCTGG - Intronic
1084591527 11:70093350-70093372 CAGCCATGGGGTCAGCTTTCAGG + Intronic
1088911368 11:114195137-114195159 CAGGCCTGGGGGCAACAGACAGG + Intronic
1089120021 11:116127143-116127165 CAGTTATGTGGGCAGGTGTCTGG - Intergenic
1090459963 11:126882135-126882157 AAGTCAAGAGGGCAGGAGTCAGG - Intronic
1092172614 12:6383498-6383520 GAGTCCTGGGGCCAGCAGGCTGG - Intronic
1092979676 12:13781825-13781847 GAGTCACGGGGTCAGCTGTCAGG + Intronic
1093588767 12:20873757-20873779 CTGTCATGGGGGCAGAAGGAGGG - Intronic
1094134111 12:27106092-27106114 CTGTCATGGTGGTGGCAGTCGGG + Intergenic
1096712487 12:53467580-53467602 AGATCAAGGGGGCAGCAGTCAGG - Intronic
1098156621 12:67606155-67606177 CAGTGCTGGGAGCAGCAGTGAGG - Intergenic
1101246905 12:102892002-102892024 CAGTCATTGGGGAAGCAGCTTGG + Intronic
1101886713 12:108670268-108670290 CAGACCTGAGGGCAGCAGGCCGG + Intronic
1102267456 12:111499560-111499582 CAGACATGGTGGCAGGAGGCAGG + Intronic
1103416514 12:120745288-120745310 CAGTCATGGGCCCGGCAGCCAGG - Intergenic
1103431582 12:120892328-120892350 CTGTCATGTGGGCAGCACTCAGG - Intronic
1104447199 12:128844196-128844218 CAGTGATGGGGCCACAAGTCAGG + Intergenic
1104594174 12:130109018-130109040 CACTCATGTGGGCAGCAGGTTGG - Intergenic
1106657401 13:31760499-31760521 CAGTTTTGGGGGCAACTGTCTGG + Intronic
1108984280 13:56563793-56563815 CAGTCCTGGGAGCAGCTTTCAGG - Intergenic
1109854128 13:68106867-68106889 CACTCATGGTGGCAGCAGCTGGG - Intergenic
1113296850 13:108968736-108968758 GAGTCAGGGGCGCAGCAGGCAGG - Intronic
1113395078 13:109940054-109940076 CAGACATGGATGCAGCAGCCAGG + Intergenic
1114431813 14:22667857-22667879 CAGTCATGGTGGCAGATGACAGG + Intergenic
1114635690 14:24185549-24185571 CAGCAGTGGGGGCAGCAGTCTGG + Exonic
1116700122 14:48230551-48230573 CAGTCAATGGGCCAGAAGTCTGG + Intergenic
1124663227 15:31568188-31568210 CAGCCATGGGGGCTGAACTCTGG + Intronic
1125097087 15:35867247-35867269 CAGGTATGGGGGCAGCTGTAGGG + Intergenic
1125714092 15:41809499-41809521 CAGATATGGGGGCTGCAGTGGGG + Intronic
1127610876 15:60635102-60635124 GAGTCATGGTGGCGGCAGCCTGG - Intronic
1128204786 15:65841374-65841396 CAGTCTGGGAGGCAGCACTCAGG + Intronic
1128695293 15:69757384-69757406 GAGTCACTGGGGCATCAGTCAGG - Intergenic
1129109284 15:73328291-73328313 CAGGCATGGGGAGAGAAGTCTGG + Intronic
1129949474 15:79573295-79573317 CAGCCCTGGGGGCAGCTGGCTGG + Intergenic
1130517908 15:84640212-84640234 CAGTCCTGTGGGAAGCATTCAGG + Exonic
1132353919 15:101157757-101157779 GAGTCCTGGGGGCAGCAGCTTGG + Intergenic
1132950251 16:2557798-2557820 CATTCCTGGTGGCAGCAGGCAGG + Exonic
1132964095 16:2642372-2642394 CATTCCTGGTGGCAGCAGGCAGG - Intergenic
1133711896 16:8409506-8409528 CAGGGAGGGGGGCAGCAGCCTGG + Intergenic
1133835038 16:9360283-9360305 CAGTCATGAGGACCACAGTCGGG + Intergenic
1135252864 16:20915812-20915834 CAGTCATGGTGGCAGAACTTGGG + Intronic
1135541700 16:23334839-23334861 CAGTCATTTGGACAGCAATCTGG - Intronic
1136293734 16:29290430-29290452 CAGTCCTGGAGCCAGCAGACAGG - Intergenic
1136620255 16:31423827-31423849 CAGTCCTGGGGGCAGAAGAGGGG - Exonic
1137929804 16:52576147-52576169 CATGCATGGGGGCAACAGTGAGG - Intergenic
1138063955 16:53921057-53921079 CAGTGATGCAGGCAGCAGTTGGG + Intronic
1138504897 16:57473397-57473419 CAGCCAGGGGGACAGCAGTGAGG - Exonic
1140816392 16:78624993-78625015 CAGTGATGGAGGCAGAACTCAGG - Intronic
1142099617 16:88264436-88264458 CAGTCCTGGAGCCAGCAGACAGG - Intergenic
1142191666 16:88720974-88720996 CATCCCCGGGGGCAGCAGTCAGG + Intronic
1147369440 17:39981339-39981361 CAGTCATTGGGCCTGGAGTCGGG - Intronic
1148047624 17:44753710-44753732 TAGTCAAGGGGGCAGGATTCAGG - Intergenic
1148212017 17:45814329-45814351 CAGTTAAGGGGGCAGCAGGAAGG - Intronic
1148765920 17:50038118-50038140 CAGTCAAGGACCCAGCAGTCTGG - Intergenic
1148930869 17:51126264-51126286 CAGTCACGGGGGCAGCAGAGGGG + Intergenic
1149302729 17:55319540-55319562 CTGTCAGGGAGGCAGCAGTGGGG + Intronic
1149540874 17:57467245-57467267 CAGTCCTGAGGCCAGGAGTCTGG + Intronic
1150379785 17:64711550-64711572 TAGTCTTGTGGGGAGCAGTCTGG + Intergenic
1150508572 17:65724876-65724898 CAGCCTTGGGGGCAGCAGGAGGG - Intronic
1150700273 17:67441016-67441038 CAGTCTTGGGTGCATCTGTCAGG + Intronic
1151220362 17:72606992-72607014 GAGACATGGGCACAGCAGTCAGG - Intergenic
1151304778 17:73256287-73256309 GAGACATGGGGGCAGCTCTCAGG + Intronic
1152863440 17:82709167-82709189 CTGGCATGGGGGCAGGAGACAGG - Intergenic
1152863536 17:82709423-82709445 CAGGCATGGGGGCAGTGGGCGGG - Intergenic
1153104368 18:1510576-1510598 CAGTAGTGGCAGCAGCAGTCAGG + Intergenic
1156087060 18:33418478-33418500 CAGTCCTGGCCACAGCAGTCAGG + Intronic
1156125423 18:33899220-33899242 CAGACATGTGGGCACCAGTGAGG - Intronic
1156483089 18:37448403-37448425 CTGTCAGTGGGGCTGCAGTCAGG - Intronic
1160035904 18:75301599-75301621 GAGTCATGGGGGCTGTAGTGGGG + Intergenic
1160220575 18:76974423-76974445 CAATGATGGGGGCAGCACTGTGG - Intergenic
1160387644 18:78506136-78506158 GGGTCATGGGGGCAGCAGCGAGG - Intergenic
1160862867 19:1245058-1245080 CAGTGATGGGGACATCGGTCAGG + Intergenic
1163179203 19:15586945-15586967 CAGGCATGGTGGCAGGAGCCTGG - Intergenic
1164843908 19:31415825-31415847 CAGTGAGGGGAGCCGCAGTCAGG + Intergenic
1164953061 19:32355159-32355181 CTGTCAAGGAGGCAGCAGGCAGG - Intronic
1165056647 19:33181417-33181439 AAGTCATGTTGACAGCAGTCTGG + Intronic
1166073176 19:40398303-40398325 CAGTAATTGGGCCAGCACTCAGG + Intronic
1166179076 19:41094496-41094518 CACTAATGGGGGCAGGATTCTGG - Intronic
1167313282 19:48749883-48749905 CATTCCTGGGGGCAGCCATCTGG + Exonic
925317936 2:2939601-2939623 CAGTCCTGGAGCCAGCAGACCGG + Intergenic
927187518 2:20492350-20492372 CTGTCATGCGGGCAGCTGCCGGG + Intergenic
927211425 2:20641295-20641317 CAGGCAGAGGGGCAGCAGGCGGG - Intronic
927214892 2:20662719-20662741 CAGACATGGGGCCAGGTGTCTGG + Intergenic
928360949 2:30661944-30661966 CACCCATGGGGACAGCAGACAGG - Intergenic
929600516 2:43201574-43201596 CAGTCCAGGGGGCAGCAGCTGGG - Intergenic
931252870 2:60549658-60549680 CGGGCATGGAGGCAGCAGTCAGG - Intronic
931851123 2:66251606-66251628 CAGTCATGGGGGCCCCAGTAGGG + Intergenic
932379309 2:71267827-71267849 CGGGCATGGTGGCAGCAGTTTGG - Intergenic
933497114 2:83063434-83063456 CAGTCATGGGCACACCAGCCAGG - Intergenic
933740637 2:85531215-85531237 CACTCATGGTGTCTGCAGTCTGG - Intergenic
934903274 2:98177706-98177728 CAGTCCTGAGGGCAGGATTCAGG - Intronic
935092080 2:99904984-99905006 CAGTGGTGGGAGCAGCAGTGGGG - Intronic
936260770 2:110958332-110958354 CAGCCATGGGGAGAGCAGGCTGG + Intronic
937274531 2:120675378-120675400 CAGGCATGGGGGAAGCCGGCGGG + Intergenic
937295924 2:120809951-120809973 CAGTGGTGGGGGCTGCGGTCAGG + Intronic
937331213 2:121031523-121031545 CAGTCACAGGGGCAGCAGCCTGG + Intergenic
938079319 2:128361140-128361162 CAGCCATTGGGGCAGGAGACTGG - Intergenic
938241112 2:129742844-129742866 CACTCGTGGGGGCTGCAGACTGG - Intergenic
941436218 2:165476551-165476573 CAGTCATGCAGGCAGCATGCCGG + Intronic
941450788 2:165657867-165657889 CAGTCAAGGGGGAAGCACCCTGG + Exonic
941635649 2:167932405-167932427 CAGCCATGGGGGCAGTGGACTGG - Intergenic
942222542 2:173784454-173784476 GTGTCATGGGGGCAGCAGAGAGG + Intergenic
942376580 2:175343835-175343857 CAGTGATGGTGGCTGCAGTTGGG + Intergenic
945907204 2:215607613-215607635 CACGCATGAGGGCAGCAGGCAGG + Intergenic
946790952 2:223300013-223300035 AAGGCATGGTGGCAGCAGTGGGG - Intergenic
1169093144 20:2873550-2873572 CAGTGATGGCGGCAGCGGCCGGG - Intronic
1169950355 20:11036668-11036690 GAGTCATGGGGGCTGCCTTCAGG - Intergenic
1170560827 20:17557036-17557058 CAGCCAGGGAGGCAGCAGTTGGG - Intronic
1171330949 20:24338525-24338547 CAGGCATGGTGGCAGCACTTGGG + Intergenic
1173401224 20:42727727-42727749 CAGTCATTGAGGCTGCAGTATGG - Intronic
1173766533 20:45615365-45615387 CAGTCAAGTGGGCAGGAGGCAGG + Intronic
1174059048 20:47819450-47819472 CAGCCATGAGGGCCGCAGACAGG + Intergenic
1175032364 20:55968660-55968682 CAGTCAAGGGTGCAACAGTTTGG - Intergenic
1175517400 20:59577990-59578012 GTGTCTTGGGGGCAGCAGTTGGG + Intronic
1175763241 20:61575231-61575253 CAGTCATGATGGCAGCAAGCTGG + Intronic
1175899082 20:62353002-62353024 CAGTCATGACCGCAGCAGCCGGG + Intronic
1179304204 21:40140083-40140105 CAGTCCCGGAGGCTGCAGTCTGG + Intronic
1179436483 21:41365799-41365821 CAGCCATGTGGAAAGCAGTCTGG - Intronic
1179506924 21:41847297-41847319 CAGTGATGACGGCAGCAGACGGG + Intronic
1180233331 21:46441534-46441556 CAGTCATCGCGGCTGCAGGCTGG + Intronic
1182773069 22:32809955-32809977 CAGGCATGGTGGCAGCACTGTGG - Intronic
1183212889 22:36461848-36461870 CACTCCTGGGAGCAGCAGTGTGG + Intergenic
1183516473 22:38269739-38269761 CAGGCAAGGGGTCAGCAGTGGGG + Intronic
1184043164 22:41956546-41956568 CAGCCATGGCAGCTGCAGTCAGG + Intergenic
1184716108 22:46282640-46282662 CTGTCAAGGGGGCAGTGGTCAGG + Intronic
1185192788 22:49449583-49449605 CAGCCATGGGGGCTGCCCTCAGG + Intronic
949637416 3:5998201-5998223 CAGTTATGGAGGCTGAAGTCTGG - Intergenic
950294887 3:11820902-11820924 CAGGCATGCAGCCAGCAGTCAGG + Intronic
950393756 3:12717895-12717917 CACTCATCGGGAGAGCAGTCTGG - Intergenic
953589358 3:44236660-44236682 CAGCCATGAGGGCAGGAGGCGGG + Intergenic
953931212 3:47006732-47006754 CAGGCCTGGGGGCAACATTCAGG - Intronic
954133391 3:48571058-48571080 CAGTTGTAGGGGCAGCAGGCCGG - Intronic
954147914 3:48643382-48643404 CAGGCCTGGGGGCAGCAGCTAGG + Intronic
955368941 3:58333651-58333673 AAGTGGTGGGGGCGGCAGTCGGG + Intronic
957241342 3:77664841-77664863 AAGTCATGGGGGAAGGACTCTGG - Intergenic
959334248 3:105044178-105044200 AAGTGATGAGGGCAGAAGTCAGG + Intergenic
959544478 3:107578252-107578274 GAGACATGGGGGGAGTAGTCAGG + Intronic
961119502 3:124361790-124361812 TAGTGATGGTGGCAGCAGTGGGG + Intronic
961119511 3:124361821-124361843 TAGTGATGGTGGCAGCAGTGGGG + Intronic
962089804 3:132231123-132231145 CAGGCATGGAGCCAGAAGTCAGG - Intronic
962241724 3:133755875-133755897 CGGTGATGGGGGCAGGAGACAGG - Intronic
968917943 4:3505368-3505390 CAGCGATGGGGCCAGCAGCCTGG - Intergenic
974015309 4:56643682-56643704 CTGTCATGGGGGGAGAAATCTGG + Intergenic
976169486 4:82288196-82288218 CTATCATTGGGGCAGCAGTGTGG - Intergenic
976427630 4:84924057-84924079 CATTAATGGGGGAAGCACTCAGG + Intronic
978563200 4:110055036-110055058 CACTCTTTGGGTCAGCAGTCTGG - Intronic
981308056 4:143267693-143267715 CAGTCATGGCTGGAGCAGTTGGG - Intergenic
985278262 4:188260074-188260096 CACCCCTGGAGGCAGCAGTCAGG - Intergenic
988443516 5:31258859-31258881 TTGTCATGTGGGCAGCAGCCTGG + Intronic
990250647 5:53911401-53911423 CAGTCATGGGGGAAGGAATGAGG - Intronic
990801518 5:59609530-59609552 CAGTCATTGTGGCAGAAGACAGG - Intronic
991191203 5:63876081-63876103 TATTCATGGGCGCAGCAGGCCGG + Intergenic
992228672 5:74642087-74642109 CAGTCTTGGTTTCAGCAGTCTGG - Intronic
992300534 5:75374593-75374615 CAGTGAAGGTCGCAGCAGTCAGG + Intronic
995532334 5:113103977-113103999 AAGTCATGATGTCAGCAGTCAGG - Intronic
996001737 5:118372396-118372418 CAGTCCTGGAGGCAGCAGGGAGG - Intergenic
998961410 5:147490862-147490884 CAGTCATGGCAGCAGCAGGGTGG + Intronic
999132166 5:149292427-149292449 CAGTCATGTGGGGAGGAGTGAGG + Intronic
1000023807 5:157341633-157341655 CAGGAATGGGGGCAAAAGTCTGG + Exonic
1001989563 5:176105072-176105094 CCATCATGGGGGCAGCAGGTGGG - Intronic
1002163901 5:177332912-177332934 GAGTCGGGGGGGCCGCAGTCAGG - Intronic
1002227309 5:177733066-177733088 CCATCATGGGGGCAGCAGGTGGG + Intronic
1005495996 6:26388364-26388386 CGGGAATGGGGGCAGCAGTGTGG + Intronic
1005500691 6:26426593-26426615 CGGGGATGGGGGCAGCAGTGTGG + Intergenic
1005505222 6:26463595-26463617 CGGGGATGGGGGCAGCAGTGTGG + Intronic
1007061770 6:38947275-38947297 CAGTCAGGTGGCCATCAGTCTGG + Intronic
1007485534 6:42178446-42178468 CAGGGCTGGGGGCAGCGGTCTGG + Intronic
1016026428 6:139292118-139292140 CACTGATGGAGGCAGCAGTCTGG + Exonic
1017983455 6:159422459-159422481 CAGTCAAGTGGGAAACAGTCTGG - Intergenic
1018269851 6:162065417-162065439 TAGCCATGGGGGCAGCAGACTGG + Intronic
1018469736 6:164084632-164084654 CTTTCATGGGGGCAGTTGTCTGG + Intergenic
1019277034 7:181318-181340 CAGTTATGGGGGCTGCGGGCAGG - Intergenic
1022963165 7:35449533-35449555 CAGTCCTGAGGGCAACAGGCAGG - Intergenic
1025042827 7:55662773-55662795 TAGTAATGGTGACAGCAGTCTGG - Intergenic
1027358613 7:77384906-77384928 GAGACATGGGGGCAGAAGGCAGG + Intronic
1032475799 7:132210800-132210822 CAGGCATGGGGGAAGCAGGTAGG + Intronic
1032526334 7:132580804-132580826 CAGCCATGGGGGCAGCTCTTGGG - Intronic
1032678687 7:134158942-134158964 CTATCATGGGGTCAGCAGGCGGG + Intronic
1032791752 7:135247593-135247615 CAGTCATTGGCTCAGCAGGCTGG - Intronic
1034336259 7:150325329-150325351 CGATCATGTGGGCAGCAGTCAGG - Intronic
1034410616 7:150939691-150939713 CAGTCATTAGGGAAACAGTCTGG - Intergenic
1034898752 7:154894430-154894452 CATCCATGGTCGCAGCAGTCTGG + Intergenic
1035224808 7:157427144-157427166 CAGTCATGCAGGCAGTCGTCGGG + Intergenic
1035366536 7:158352149-158352171 CGGTCAGGAGGGGAGCAGTCAGG - Intronic
1035366550 7:158352194-158352216 CAGTCAGGAGGGGAGCAGTCAGG - Intronic
1035366577 7:158352284-158352306 CAGTCAAGAGGGGAGCAGACAGG - Intronic
1037386433 8:18347617-18347639 CAGTCAATGGTGAAGCAGTCTGG - Intergenic
1040684291 8:49852668-49852690 CAGCCATGTGGGAAGCAGTTTGG + Intergenic
1040766824 8:50921253-50921275 CAGTCATGGGGACAGCAAGCAGG - Intergenic
1041829970 8:62143270-62143292 GAGTCAGGAGGGCATCAGTCCGG + Intergenic
1043815384 8:84794711-84794733 CAGCTTTGGGGGCAGCAGTGAGG - Intronic
1044199628 8:89418428-89418450 GAGTCATAGGGGCTGCAGTAAGG + Intergenic
1045057846 8:98384734-98384756 CAGACATGGGGCCAGCAGGAGGG - Intergenic
1045231446 8:100310312-100310334 CAGGCGTGGGGGCCGCAGTCGGG - Intronic
1045492468 8:102680716-102680738 CGGTCCTGGAGTCAGCAGTCAGG - Intergenic
1046870952 8:119205519-119205541 CAGGCATGGGGGTGGCAGTGGGG + Intronic
1048226928 8:132596817-132596839 GAGTGATGGGGGCATCAGCCTGG + Intronic
1048233996 8:132673156-132673178 CAGTCCTGTGGGCGGCAGTGCGG + Intronic
1049039949 8:140105037-140105059 CAGTCCTGGGGGCAGGTGGCTGG - Intronic
1049061380 8:140278706-140278728 CAGTGATGAGGGCAGAGGTCAGG - Intronic
1049235235 8:141508821-141508843 CAGGCCTTGGGGCAGCAGCCAGG - Intergenic
1049257649 8:141622499-141622521 CAGTGATGGGGACAGCAATGAGG - Intergenic
1049576305 8:143391532-143391554 CACTGATGGAGGCAGCTGTCAGG - Intergenic
1049655250 8:143794336-143794358 CAGTCATGGGGGCAGCAGTCAGG - Intronic
1049767356 8:144361058-144361080 CAGGCATGGTGGCAGCATTGAGG - Exonic
1049802389 8:144524003-144524025 CAGGCAACTGGGCAGCAGTCTGG - Exonic
1049862915 8:144912625-144912647 CAGTCATGGCTGGAGCAGCCGGG - Intergenic
1058600308 9:106661888-106661910 CAGTCATAGGGGAAATAGTCAGG + Intergenic
1058883684 9:109306678-109306700 CAATCTTGGTGGCAGTAGTCTGG + Intronic
1061908295 9:133709945-133709967 GATTCTTGGGGGCAGCAGTGAGG + Intronic
1062037703 9:134390069-134390091 CCGTCCTGGGGGCAGCAGGCCGG + Intronic
1062597798 9:137306898-137306920 CGGCCATGGGCCCAGCAGTCGGG + Exonic
1187711374 X:22057884-22057906 CAGTTGTGGGGGCAGCTGACTGG + Intronic
1192312942 X:70031666-70031688 CAGACATGGAGGTGGCAGTCAGG - Intronic
1195271709 X:103237716-103237738 CAGTCATGGGGGAAAGAATCTGG - Intergenic
1200071987 X:153533777-153533799 CAGCCATGGCTGCACCAGTCAGG + Intronic
1201479036 Y:14417409-14417431 CAGAAATGGTGGGAGCAGTCAGG + Intergenic