ID: 1049655251

View in Genome Browser
Species Human (GRCh38)
Location 8:143794347-143794369
Sequence GAACAACAGCACAGTCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 245}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049655251_1049655256 -10 Left 1049655251 8:143794347-143794369 CCCCCATGACTGTGCTGTTGTTC 0: 1
1: 0
2: 2
3: 22
4: 245
Right 1049655256 8:143794360-143794382 GCTGTTGTTCATGAGGATGAAGG No data
1049655251_1049655257 -9 Left 1049655251 8:143794347-143794369 CCCCCATGACTGTGCTGTTGTTC 0: 1
1: 0
2: 2
3: 22
4: 245
Right 1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG No data
1049655251_1049655264 26 Left 1049655251 8:143794347-143794369 CCCCCATGACTGTGCTGTTGTTC 0: 1
1: 0
2: 2
3: 22
4: 245
Right 1049655264 8:143794396-143794418 CTCCCTCTTGGCGCTGCCCATGG No data
1049655251_1049655258 -1 Left 1049655251 8:143794347-143794369 CCCCCATGACTGTGCTGTTGTTC 0: 1
1: 0
2: 2
3: 22
4: 245
Right 1049655258 8:143794369-143794391 CATGAGGATGAAGGGCCTCCCGG No data
1049655251_1049655260 14 Left 1049655251 8:143794347-143794369 CCCCCATGACTGTGCTGTTGTTC 0: 1
1: 0
2: 2
3: 22
4: 245
Right 1049655260 8:143794384-143794406 CCTCCCGGAAGCCTCCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049655251 Original CRISPR GAACAACAGCACAGTCATGG GGG (reversed) Intronic
901340315 1:8492468-8492490 GAACAACTGGCCAGACATGGTGG + Intronic
902136185 1:14307603-14307625 GATCAACAGCACTGTCTTTGGGG - Intergenic
902221988 1:14972191-14972213 GAAGACCTGCACAGTGATGGAGG - Intronic
904273341 1:29364601-29364623 GAACAACAGGACAATCATAGTGG + Intergenic
904543449 1:31249678-31249700 GAGCAACAGGCCAGGCATGGTGG - Intergenic
904717303 1:32478222-32478244 GAAAAACAGGCCAGGCATGGTGG + Intronic
906401605 1:45508760-45508782 GAAGAAAAGCAAGGTCATGGAGG - Intronic
906956252 1:50377373-50377395 GCACAACAGCACAGTCAGCTTGG + Intergenic
907293748 1:53435470-53435492 GAACAGCAGGACGGGCATGGTGG + Intergenic
908674488 1:66588005-66588027 CAACAACAACAAAATCATGGGGG + Intronic
909521733 1:76576243-76576265 GAACAAAAACACTATCATGGAGG - Intronic
909664814 1:78121238-78121260 CAACAGCAGCAAAGGCATGGGGG + Intronic
909891563 1:81014080-81014102 CAAAAACAGGCCAGTCATGGTGG - Intergenic
910471449 1:87557561-87557583 GAACAACCGTAGAGTCAGGGAGG - Intergenic
910745578 1:90570549-90570571 GATCAACAGCACAGTCTAGAAGG + Intergenic
913025722 1:114837463-114837485 GATCCACAGGACAGTGATGGTGG + Intergenic
913166110 1:116187219-116187241 GAACAATAGGCCAGGCATGGTGG - Intergenic
916491070 1:165302977-165302999 GAATAACAGCAAAGTAATGAAGG - Intronic
916705052 1:167340712-167340734 AAACAACAGGGCAGGCATGGTGG - Intronic
916963456 1:169911751-169911773 GAAAAAAAGCCCAGGCATGGTGG - Intergenic
917362871 1:174196103-174196125 GAACTACAGCCCAGGCGTGGTGG - Intronic
917759020 1:178135033-178135055 GAGCAAGAGCACTATCATGGTGG - Intronic
919310664 1:195902965-195902987 GGACAACAGCCAATTCATGGCGG - Intergenic
919841443 1:201612161-201612183 AAACAACAGGCCAGGCATGGTGG + Intergenic
922748058 1:228058323-228058345 GAACATCAGAACAGTCTAGGTGG - Intronic
924521908 1:244812888-244812910 AAAAAACAGCCCAGGCATGGTGG + Intergenic
1063163825 10:3441961-3441983 GTACAACAGGCCAGTCACGGTGG - Intergenic
1063245454 10:4213138-4213160 GAAAAGTTGCACAGTCATGGGGG - Intergenic
1063829715 10:9938321-9938343 GAACAACTGGACATCCATGGGGG - Intergenic
1066564532 10:36707362-36707384 GAACAACAAGCCAGGCATGGTGG + Intergenic
1066671890 10:37849144-37849166 TAACAACAGGCCAGACATGGTGG + Intronic
1069697535 10:70398016-70398038 GAGCCACAGCCCAGTGATGGAGG - Intergenic
1072046481 10:91661443-91661465 GAGCAAGAGCATTGTCATGGTGG + Intergenic
1072155713 10:92721859-92721881 GAAGAACAGTACAGTCAAGGGGG + Intergenic
1072400666 10:95096132-95096154 GAACACCAGCTTAGTCATGCTGG - Intergenic
1072837627 10:98733407-98733429 AAATAACAGGCCAGTCATGGTGG - Intronic
1073109355 10:101051729-101051751 TAACAACAGGCCAGGCATGGTGG - Intergenic
1073413527 10:103362429-103362451 GAAAAACAGGCCAGGCATGGTGG - Intergenic
1073640418 10:105247125-105247147 TACCAAAAGCACAGTGATGGTGG + Intronic
1077159329 11:1105520-1105542 GCAGAACAACACAGTCCTGGTGG + Intergenic
1077279151 11:1734208-1734230 GAACTCAGGCACAGTCATGGGGG - Exonic
1078051171 11:7965900-7965922 GAAAAACAGGCCAGGCATGGTGG + Intergenic
1078203825 11:9210256-9210278 GGACAATAGGACAGTCATGTTGG - Intronic
1081904001 11:46654809-46654831 GAAAAACAGGCCAGGCATGGTGG + Intronic
1082977200 11:59084858-59084880 GAATCACAGCAGATTCATGGAGG - Intergenic
1085292955 11:75413058-75413080 TAAAAACAGGACAGGCATGGTGG - Intronic
1085524895 11:77158335-77158357 GAACATGAGCACCTTCATGGCGG - Exonic
1086314314 11:85574446-85574468 GAATAACAGAAGAGTCAAGGAGG - Intronic
1087039619 11:93785717-93785739 AAATAACAGGACAGGCATGGTGG + Intronic
1088568357 11:111196876-111196898 GGTCACCCGCACAGTCATGGTGG - Intergenic
1089535873 11:119160563-119160585 GAACAAGAGGACAGGGATGGCGG - Exonic
1090130924 11:124141467-124141489 GAAAAATAGCACAGTAAGGGTGG + Intronic
1090831238 11:130422150-130422172 GAACATCAGGCCAGTCAGGGTGG + Intronic
1091991408 12:4958980-4959002 GAAGAACAGCCAAGTCGTGGTGG - Intergenic
1093213469 12:16334964-16334986 GAACAACAGGCCAGACATTGAGG + Intergenic
1095120856 12:38416915-38416937 GAATTACAGGACAGGCATGGTGG - Intergenic
1095555061 12:43492512-43492534 TAAGAACAGCAGTGTCATGGTGG + Exonic
1098154473 12:67583176-67583198 GTAGAGCAGCACAGTCAAGGGGG - Intergenic
1098572979 12:72009893-72009915 TAAAAACAGCACAGTCTTTGGGG + Intronic
1099765577 12:86978820-86978842 GAACAGGAGCATTGTCATGGTGG + Intergenic
1101121069 12:101580420-101580442 GAACAACAGGCCAGGCATGGTGG - Intronic
1102264128 12:111467293-111467315 AAAAAAAAGCCCAGTCATGGTGG - Intronic
1102966788 12:117133925-117133947 GAACAACTGCTGAGTCTTGGTGG + Intergenic
1103630760 12:122258691-122258713 GAATAACAGGCCAGGCATGGTGG + Intronic
1103945665 12:124525073-124525095 GAAAAACAGCCCAGCCCTGGAGG + Intronic
1107052090 13:36061879-36061901 GAAAAACAACACATTGATGGTGG - Intronic
1107090780 13:36476720-36476742 CAACAACAGGCCAGGCATGGTGG - Intergenic
1108462745 13:50683526-50683548 GAACCACAGCACAGAAATGATGG - Intronic
1111436035 13:88209277-88209299 GAACACCAGGAAAGACATGGAGG + Intergenic
1115594338 14:34894627-34894649 AAACAACAGCATAGGAATGGAGG - Intergenic
1117953153 14:61102771-61102793 TACCAACAGCACAGGCATTGTGG - Intergenic
1118213283 14:63785816-63785838 GAAAAACAGCACAGGCATGGTGG + Intergenic
1119538149 14:75419605-75419627 ACACAACAGCCCAGTCATAGGGG + Intergenic
1123047190 14:105524375-105524397 AAACAACAGGCCAGGCATGGTGG - Intergenic
1202890355 14_KI270722v1_random:151094-151116 TAACATCAGGACAGGCATGGGGG + Intergenic
1123771040 15:23529523-23529545 GAACAAAAGCACACTGATGCAGG - Intergenic
1126845970 15:52760922-52760944 GAACAAGTGCACAGTCCTGAAGG - Intronic
1127302698 15:57672292-57672314 TGAGAGCAGCACAGTCATGGTGG - Intronic
1128131469 15:65229972-65229994 GAAAAACAGGCCAGGCATGGTGG + Intergenic
1128692002 15:69731748-69731770 GAGCAACAGTGCAGTCCTGGCGG + Intergenic
1128765455 15:70248438-70248460 GAATAACAGAACAGTCACAGAGG + Intergenic
1128776153 15:70322027-70322049 GAATGACAGCACAGTGGTGGAGG - Intergenic
1129824180 15:78624000-78624022 GACCAGCACCGCAGTCATGGAGG + Intergenic
1130191329 15:81738860-81738882 GAAAAACAGCACAGGCCAGGAGG + Intergenic
1130303015 15:82694396-82694418 GAACCACAGGCCAGGCATGGTGG + Intronic
1130513941 15:84611459-84611481 CAACAACAGGCCAGTCGTGGTGG + Intronic
1131190610 15:90313418-90313440 GAAAAACAGGCCAGGCATGGTGG - Intronic
1131211333 15:90499271-90499293 GCACAACAGGACAGAGATGGAGG - Intronic
1132403879 15:101530653-101530675 AACCAGCAGCACACTCATGGAGG + Intergenic
1132957817 16:2605218-2605240 GAACTATAGCACAGTTAAGGTGG + Intergenic
1134116378 16:11551958-11551980 AAACAACAGCAGAGTCCTGTGGG + Intronic
1134773635 16:16832674-16832696 GAACAAGGGCACAGGCTTGGAGG + Intergenic
1135099283 16:19592365-19592387 GAAAAACAGGCCAGGCATGGTGG - Intronic
1135485469 16:22861247-22861269 GAACCACAGCCCAGTCTGGGGGG + Intronic
1135512924 16:23103625-23103647 GAAAAACAGGACAGGCATGGTGG + Intronic
1136082419 16:27860806-27860828 CAAGGACATCACAGTCATGGAGG + Intronic
1136386204 16:29927505-29927527 CACCAACAGCACGGCCATGGTGG + Intergenic
1139019357 16:62728228-62728250 GAACAATAACACAAACATGGTGG + Intergenic
1140773344 16:78226722-78226744 GAACCACAGCATAGCCATGCCGG - Intronic
1146179827 17:30690701-30690723 GAACAACAGGCCAGGCACGGTGG + Intergenic
1149608419 17:57941247-57941269 GGAGAAAAGCTCAGTCATGGGGG - Intronic
1151090862 17:71438858-71438880 AAACAACAGCACAGTTAATGGGG - Intergenic
1151777726 17:76218644-76218666 GAAAAACAGGCCAGGCATGGTGG + Intronic
1152443457 17:80325220-80325242 GAACATCAGCTCAGGCAAGGTGG + Intronic
1154354256 18:13612722-13612744 GAACAACAGCACACTGAAGGAGG + Intronic
1156426976 18:37024286-37024308 GAATAACAGGCCAGGCATGGTGG - Intronic
1156591589 18:38495799-38495821 AAACAAAACGACAGTCATGGAGG + Intergenic
1156592378 18:38505576-38505598 GAACAGGAGCATTGTCATGGTGG + Intergenic
1158493594 18:57932674-57932696 GAACAGGAGCACTGTCATGATGG + Intergenic
1160134394 18:76260287-76260309 GAAGAAAAGCAAAGTCCTGGGGG + Intergenic
1162431527 19:10631717-10631739 GAAAAACATCACAGACCTGGTGG + Exonic
1163794640 19:19330305-19330327 CAACAACAGGCCAGGCATGGTGG + Intronic
1164487188 19:28668538-28668560 GAAGAACAGCAGAGTTCTGGTGG - Intergenic
1165698859 19:37921888-37921910 GAAAAACAGGCCAGGCATGGTGG - Intronic
1167671074 19:50854093-50854115 AAACGACAGGTCAGTCATGGTGG - Intergenic
1202665777 1_KI270708v1_random:117923-117945 TAACATCAGGACAGGCATGGGGG + Intergenic
926531354 2:14050023-14050045 GAGCAAAAGCACTGTCGTGGTGG - Intergenic
926592927 2:14758887-14758909 GAACAACAGCAGAGGCAAGGGGG + Intergenic
926947063 2:18199943-18199965 GCACAGCTGCACAGTCATGCTGG + Intronic
927263758 2:21121379-21121401 GAACATCAGTACACTCTTGGTGG + Intergenic
928047163 2:27947321-27947343 GAACACTAGAACAGCCATGGGGG - Intronic
928239516 2:29574396-29574418 GAACACCAGCACAGACAGGTGGG - Intronic
928410909 2:31053151-31053173 GAACACCAGCACAGGCATATAGG - Intronic
929366520 2:41164297-41164319 GAACACCAGGTCAGGCATGGTGG - Intergenic
931373001 2:61681640-61681662 GATCAATAGCCCAGGCATGGTGG - Intergenic
931493610 2:62777767-62777789 GTACTACAGGACAGTAATGGAGG + Intronic
932113897 2:69027236-69027258 GGACAGGATCACAGTCATGGAGG - Intronic
933878189 2:86640926-86640948 GAAAAACAGGCCAGGCATGGTGG - Intronic
938026045 2:127949377-127949399 GAACAACAGAACATTCATTGAGG + Intronic
938764144 2:134449320-134449342 GAACAACAGTATAGTGAAGGTGG - Exonic
939117817 2:138080660-138080682 GTACAAAAGGACAGTCATGGGGG - Intergenic
941494681 2:166185054-166185076 GAGCAGCAGCACAGTCAAGCAGG + Intergenic
942921788 2:181383052-181383074 AAACAATAGGACAGTCATTGTGG + Intergenic
943721591 2:191208625-191208647 GAACAACAGCACAATCAGCCAGG + Intergenic
944654851 2:201867335-201867357 TAATAACAGCCCAGGCATGGTGG + Intronic
944953080 2:204775583-204775605 GAACCTCAGCCAAGTCATGGAGG - Intronic
945741063 2:213661917-213661939 GAACATCAGCACAGTCTTTGAGG - Intronic
946807508 2:223485896-223485918 GAACATCAGCAGAGAGATGGTGG - Intergenic
948877072 2:240835231-240835253 GAACAAAAACACAGTCACTGTGG - Intergenic
1169162128 20:3389746-3389768 GAAAAACAGGCCAGGCATGGTGG + Intronic
1171180312 20:23086442-23086464 GAACAACAGCACCGTGATGAAGG - Intergenic
1173061799 20:39669511-39669533 GAAAAACAACACAATTATGGGGG - Intergenic
1173224462 20:41154157-41154179 GAACAAAAGCACTGGCAAGGTGG - Intronic
1177456332 21:21344295-21344317 AAATAATAGCACAGCCATGGGGG + Intronic
1178711897 21:34924531-34924553 CAACATGTGCACAGTCATGGTGG + Intronic
1180332490 22:11494853-11494875 TAACATCAGGACAGGCATGGGGG + Intergenic
1181307137 22:21923226-21923248 CGACAACATCACGGTCATGGTGG - Exonic
1181490315 22:23257325-23257347 GAAAAACAGCACAGGCAGGAAGG - Intronic
1182198874 22:28548803-28548825 GAACATCATGACTGTCATGGGGG - Intronic
1182355759 22:29721595-29721617 CAAGACCAGCACAGTCAGGGAGG + Intronic
1184051188 22:42006096-42006118 GAACAGGAGCATTGTCATGGTGG - Intronic
952871004 3:37901323-37901345 GAAGAACAGCACAGACACAGAGG - Intronic
953026204 3:39146665-39146687 CTTCAACAGCCCAGTCATGGTGG + Exonic
953333874 3:42077573-42077595 GAAAAACAGTCCAGGCATGGTGG - Intronic
954959121 3:54549157-54549179 AAACAACAGGCCAGGCATGGTGG + Intronic
955578489 3:60392988-60393010 GAACAGGAGCATTGTCATGGTGG - Intronic
955906830 3:63816069-63816091 GAAAAACAGGCCAGGCATGGTGG - Intergenic
956486353 3:69726113-69726135 GAGCAGGAGCACTGTCATGGTGG + Intergenic
961602592 3:128072898-128072920 GAACTAATGCACAGTGATGGGGG + Intronic
961695419 3:128700908-128700930 CAACAACAGGCCAGGCATGGTGG - Intergenic
963775299 3:149433111-149433133 CAAGAACAGCACAGCTATGGTGG - Intergenic
965597456 3:170422708-170422730 TAACAACAGGCCAGGCATGGTGG - Intronic
967144101 3:186591494-186591516 GAACATCAGAACAGCCATGGAGG + Intronic
967271092 3:187733636-187733658 GAAGAACATCACTGGCATGGCGG + Exonic
967939581 3:194755849-194755871 CAGCAACATCACAGTCCTGGAGG + Intergenic
970140428 4:12976205-12976227 GAACAGCAGCACAAACATTGAGG + Intergenic
971370746 4:26016750-26016772 TAACATCATCACAGTCATTGGGG - Intergenic
971490905 4:27211292-27211314 GAAAAACAGCACAGTTTTGAGGG + Intergenic
972337556 4:38121118-38121140 GAACAACAGCACAGACAGACTGG - Intronic
972373585 4:38449427-38449449 GTACAACAGGCCAGGCATGGTGG - Intergenic
972688971 4:41378109-41378131 GAACATGAGCAGAGGCATGGAGG + Intronic
975512251 4:75206885-75206907 GAACTATAGCACAGTCCTGGAGG + Intergenic
977384821 4:96325557-96325579 AAGCAATAGCACATTCATGGAGG + Intergenic
978300605 4:107265671-107265693 GAACAACAGCACATTCCTGGAGG + Intronic
978496709 4:109367385-109367407 GAAAAATAGCAGAGTTATGGTGG - Intergenic
979504553 4:121480563-121480585 GAAGGAGAGCACAGTGATGGGGG - Intergenic
980712637 4:136590670-136590692 GAAGAAGAGCACAGTGATTGTGG + Intergenic
981399123 4:144291660-144291682 GAACAAGAACAGAGACATGGAGG + Intergenic
982326539 4:154135069-154135091 CAGCAGCACCACAGTCATGGTGG - Intergenic
984061737 4:174997094-174997116 GAGTAAAAGCACTGTCATGGTGG + Intergenic
984869562 4:184314277-184314299 GCACAGCAGGACAGTCCTGGAGG + Intergenic
987769127 5:22277543-22277565 AAACAACAGGCCAGGCATGGTGG + Intronic
988694735 5:33609890-33609912 GAAAAACAGGCCAGGCATGGTGG + Intronic
989052006 5:37330860-37330882 CAACAACAGGCCAGGCATGGTGG + Intronic
989056974 5:37375084-37375106 GAAAAACAGGTCAGGCATGGTGG - Intergenic
990409430 5:55526412-55526434 GAACAAAAGCAGAGGCTTGGAGG - Intronic
991433045 5:66568235-66568257 ATACAACAGCACAATTATGGTGG - Intergenic
993580524 5:89654316-89654338 GTAACACAGCACAGTCATAGTGG + Intergenic
996906692 5:128608972-128608994 GAAGAACAGCACAGTGACTGTGG - Intronic
998333212 5:141347440-141347462 GAATAACAGGCCAGGCATGGTGG - Intronic
998816791 5:146022584-146022606 GAACAACAGGCCAGGCACGGTGG + Intronic
999240344 5:150124145-150124167 GCACAACAGCACACTCCTGCTGG - Intronic
999294067 5:150447037-150447059 GCAACACAGCTCAGTCATGGTGG + Intronic
1001608679 5:172982714-172982736 GAAAAACAGGCCAGGCATGGTGG - Intergenic
1001786051 5:174414511-174414533 CAACATCAGCACTGTCAAGGAGG + Intergenic
1002319148 5:178364784-178364806 GTTCATCAGCAGAGTCATGGGGG - Intronic
1004930478 6:20458491-20458513 AAAAAACAGCTCACTCATGGTGG + Intronic
1006150241 6:31983175-31983197 TGACACCATCACAGTCATGGTGG + Exonic
1006156542 6:32015913-32015935 TGACACCATCACAGTCATGGTGG + Exonic
1006479550 6:34280752-34280774 GAACAGCAGCAGAGTTCTGGTGG + Exonic
1007221816 6:40284648-40284670 AAACATCAGCAAAGTCTTGGAGG - Intergenic
1007491579 6:42227100-42227122 GAAGCAGAGCAAAGTCATGGAGG + Exonic
1007989123 6:46236925-46236947 TAACAACAGCTCTGTCATGTGGG + Intronic
1008028090 6:46661733-46661755 GAATGACAGCACTGTCATGAGGG + Intronic
1010126599 6:72439808-72439830 GAGCAAGAGCATTGTCATGGAGG - Intergenic
1010908588 6:81523934-81523956 GAACAGCAGCAAGGTCATGGTGG - Intronic
1011661140 6:89595074-89595096 GAAGAACCGGCCAGTCATGGTGG + Intronic
1012534989 6:100284555-100284577 GAACTACAGGAAAGTCATTGTGG - Intergenic
1013165877 6:107591544-107591566 GGAAAATAGCACAGGCATGGAGG + Intronic
1015068210 6:129056881-129056903 AAAAAATAGCACAGGCATGGTGG - Intronic
1015232616 6:130933749-130933771 AAATAACAGCACAGGCATGGGGG - Intronic
1018218854 6:161558865-161558887 GAAAAACAGCAGGGTCATGGGGG - Intronic
1019722739 7:2583155-2583177 AAACGAAAGCAAAGTCATGGAGG - Intronic
1019991312 7:4693647-4693669 GGAGAACAGCAGAGTGATGGGGG + Intronic
1020065345 7:5184108-5184130 GAACAACAGCCCAGTCTTACAGG - Intergenic
1020569449 7:9840255-9840277 GAATAACAGCACAGACTTTGAGG - Intergenic
1021643826 7:22768135-22768157 TAAAAACAGTCCAGTCATGGTGG + Intergenic
1024562709 7:50657972-50657994 GAAAAACAGAAAAGACATGGAGG + Intronic
1024821639 7:53337580-53337602 AAACAACAACATCGTCATGGAGG - Intergenic
1026195056 7:68165503-68165525 GAACATCAGGCCAGGCATGGTGG + Intergenic
1027063600 7:75105214-75105236 AAACAACAGACCAGGCATGGTGG + Intronic
1030883850 7:114915162-114915184 GTACAACAGGCCAGGCATGGTGG + Intergenic
1031256047 7:119450219-119450241 GAGCAACTGCACACTAATGGGGG + Intergenic
1032452903 7:132049726-132049748 GAACAACTACAAAGTCATGGTGG + Intergenic
1033526246 7:142216966-142216988 GAACAAAGCCACATTCATGGAGG - Intronic
1036019490 8:4828377-4828399 TAACTACAGCAAAGTCATTGTGG - Intronic
1036142510 8:6221316-6221338 AAAAAACAGCACAACCATGGTGG - Intergenic
1036561390 8:9903001-9903023 GAACAAAAACACAGTCACGGAGG + Intergenic
1037214589 8:16433442-16433464 GAAAAACACCACAGACATAGTGG + Intronic
1037527495 8:19741082-19741104 GAACAACACCCCAGTCTTGGAGG - Intronic
1037949800 8:23011570-23011592 GAACAAGAACTGAGTCATGGGGG + Intronic
1039039061 8:33389733-33389755 GAAAAACAGCCCAGTCATGATGG + Exonic
1041157258 8:55001045-55001067 GAACTTCAGCACAGGCATGATGG + Intergenic
1041638778 8:60174376-60174398 GATCAAAAGCACAGTGCTGGAGG + Intergenic
1041926077 8:63237651-63237673 GAACAACAGCCCGGGCACGGTGG - Intergenic
1043069539 8:75621082-75621104 GAACAGCAGCAGAGTTCTGGTGG + Intergenic
1043798445 8:84576987-84577009 GAACAAGAAGACAGTCAAGGTGG - Intronic
1044678278 8:94751439-94751461 GAACAACAGCATAGTAGTGGTGG - Intronic
1045333208 8:101174987-101175009 GAACAGGAGCATTGTCATGGTGG - Intergenic
1045781950 8:105875721-105875743 GAGCAGCAGCACTGCCATGGTGG + Intergenic
1047170165 8:122484948-122484970 TAACAACATCAAAGTCAGGGAGG - Intergenic
1049121684 8:140745264-140745286 GAAGCACAGAACAGTCATGTTGG + Intronic
1049655251 8:143794347-143794369 GAACAACAGCACAGTCATGGGGG - Intronic
1052324678 9:27204974-27204996 GGCCAACAGCACAGTCAGGCAGG - Exonic
1052765911 9:32640788-32640810 AGACAACAGCAGAGACATGGGGG + Intergenic
1052901479 9:33797853-33797875 GCACAACATCAAAGTCCTGGAGG + Exonic
1054750420 9:68899248-68899270 CCACAACAGCACGGTCTTGGAGG - Intronic
1056220387 9:84445856-84445878 GAGCTACAGCACAGTTTTGGTGG + Intergenic
1056794463 9:89648066-89648088 GACCCACAGCACAGACAAGGGGG - Intergenic
1056899530 9:90584886-90584908 GGACAAGGGCACAGCCATGGAGG + Intergenic
1057498967 9:95581801-95581823 GGTTAACAGCACAGTCTTGGGGG + Intergenic
1057699186 9:97350371-97350393 GAGGAACAGGACAGTGATGGGGG - Intronic
1058439483 9:104993703-104993725 GAGCAGCAACACAGTCTTGGGGG - Intergenic
1059768537 9:117406439-117406461 GAAGAAAAGAACAGTCATGTAGG - Intronic
1060080561 9:120640208-120640230 GAGCAACAGCAAAGTCATTGTGG - Intronic
1061876373 9:133546200-133546222 GAACAACAGCCCAGAGCTGGTGG - Intronic
1062582256 9:137233907-137233929 GAAGAACAGCACAGCCCCGGCGG + Exonic
1185634255 X:1539815-1539837 GAACAACAGGCCAGGCGTGGTGG + Intergenic
1189278343 X:39803608-39803630 CAACAACAGGACAGGCATGGTGG - Intergenic
1189412004 X:40780597-40780619 GAAGGAGAGCACAGTGATGGTGG - Intergenic
1194782289 X:98039024-98039046 GCATAACATCAAAGTCATGGAGG - Intergenic
1196234601 X:113263326-113263348 GAAGAAAAGCACAGTGATTGTGG - Intergenic
1196239395 X:113324175-113324197 GAGCAAAAGCATTGTCATGGTGG + Intergenic
1197102529 X:122673275-122673297 GAACACCAGCACAGTATTTGGGG - Intergenic
1197404539 X:126033965-126033987 GAACTACTGGCCAGTCATGGTGG + Intergenic
1197992843 X:132336557-132336579 GAACAGGAGCATTGTCATGGTGG - Intergenic
1198729500 X:139713831-139713853 GAGCAAGAGCATTGTCATGGTGG + Intergenic
1199029700 X:142982254-142982276 GTAAATCAGCACAGTCATAGTGG - Intergenic
1199886008 X:152022583-152022605 TAACAAGAGCAAAGGCATGGTGG - Intergenic
1200041409 X:153373016-153373038 GAACAGCAGCTCAGTCTGGGAGG + Intergenic