ID: 1049655252

View in Genome Browser
Species Human (GRCh38)
Location 8:143794348-143794370
Sequence TGAACAACAGCACAGTCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049655252_1049655260 13 Left 1049655252 8:143794348-143794370 CCCCATGACTGTGCTGTTGTTCA 0: 1
1: 0
2: 3
3: 13
4: 166
Right 1049655260 8:143794384-143794406 CCTCCCGGAAGCCTCCCTCTTGG No data
1049655252_1049655257 -10 Left 1049655252 8:143794348-143794370 CCCCATGACTGTGCTGTTGTTCA 0: 1
1: 0
2: 3
3: 13
4: 166
Right 1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG No data
1049655252_1049655258 -2 Left 1049655252 8:143794348-143794370 CCCCATGACTGTGCTGTTGTTCA 0: 1
1: 0
2: 3
3: 13
4: 166
Right 1049655258 8:143794369-143794391 CATGAGGATGAAGGGCCTCCCGG No data
1049655252_1049655264 25 Left 1049655252 8:143794348-143794370 CCCCATGACTGTGCTGTTGTTCA 0: 1
1: 0
2: 3
3: 13
4: 166
Right 1049655264 8:143794396-143794418 CTCCCTCTTGGCGCTGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049655252 Original CRISPR TGAACAACAGCACAGTCATG GGG (reversed) Intronic
901592155 1:10353560-10353582 TGAAGCACAGCAAAGTCCTGTGG - Intronic
908435593 1:64102524-64102546 TGAATAAAAGCACAGCTATGAGG - Intronic
910521960 1:88133149-88133171 TGAACTACTGCACAGTTATCAGG + Intergenic
910528556 1:88209420-88209442 TGAGCAGCAGCACGGTCATGTGG - Intergenic
913083337 1:115410546-115410568 TGAAAGACAGCACAGTCAAGTGG - Intergenic
913157986 1:116118685-116118707 GGAACAATTGCACAGGCATGAGG + Intronic
916623375 1:166526229-166526251 TGAATAACAGAAGAGTCATCAGG + Intergenic
917929806 1:179815440-179815462 AGAGCAACAGCCCAGTCCTGAGG + Exonic
918759307 1:188381226-188381248 GAAACACCAGCACACTCATGTGG + Intergenic
919996542 1:202756841-202756863 TTGACAACAGCACAGTAATAAGG + Intronic
920410596 1:205757139-205757161 TGCTCAACATCACAGTCATCAGG - Intergenic
920871383 1:209798046-209798068 TGAAGAACCTCACAGGCATGAGG + Intronic
921563091 1:216681944-216681966 TGAACATCAGCACGTGCATGTGG - Intronic
921575916 1:216834558-216834580 TTAACAAAATCACAGTCAGGAGG + Intronic
921835177 1:219771339-219771361 TGAACAAGGGCACACTAATGTGG - Intronic
922661876 1:227437094-227437116 TAAACAATAGCTCTGTCATGAGG + Intergenic
923789670 1:237101040-237101062 TGAAGGAAAGCACCGTCATGCGG - Intronic
924022488 1:239799092-239799114 TGAACACCAGCAAAATAATGAGG + Intronic
1063097277 10:2919344-2919366 TGAACAACAGCATAAAAATGAGG + Intergenic
1063643926 10:7859562-7859584 TTATCAACAGCAAAGACATGAGG - Intronic
1065046218 10:21749431-21749453 TGGACATCAGCACCTTCATGCGG + Intergenic
1067025391 10:42839303-42839325 TGAACCACAGCAGGATCATGTGG - Intergenic
1072155712 10:92721858-92721880 TGAAGAACAGTACAGTCAAGGGG + Intergenic
1076775339 10:132692996-132693018 TGAATAACAGAAAAGTCATAAGG + Intronic
1078550365 11:12276023-12276045 TGAGCCACAGCACAGTGATGCGG + Intergenic
1081393931 11:42562668-42562690 TGTACAAGAGCACAGTTATATGG + Intergenic
1081968187 11:47182244-47182266 TTAATAACACCACAGCCATGAGG + Intronic
1083270692 11:61570982-61571004 GGAATAATAGCACCGTCATGGGG - Intronic
1085629195 11:78099173-78099195 TGGACAACAGCAAAGACGTGAGG + Intergenic
1087390832 11:97531508-97531530 TCACCAACAACACAGTGATGAGG + Intergenic
1087938124 11:104059709-104059731 TCAACAACAGCAGAGTCTTCAGG - Intronic
1089231949 11:116985371-116985393 TAATCTACAGCACAGTTATGAGG + Intronic
1089925393 11:122251748-122251770 TAGAAAACAGCACGGTCATGTGG + Intergenic
1093172952 12:15879448-15879470 TTATCATCAGCACAGCCATGGGG - Intronic
1096937408 12:55297730-55297752 TGGAAAACAGTGCAGTCATGGGG - Intergenic
1098720043 12:73885360-73885382 TGATCAGCACCACAGTCAAGAGG + Intergenic
1098927884 12:76372880-76372902 TGCATAAAAGCACAGTCCTGGGG + Intronic
1105439065 13:20400859-20400881 GGCACAACAGAGCAGTCATGTGG + Intergenic
1107172661 13:37361377-37361399 GGAAAAACAGCACAGTCAGGAGG + Intergenic
1108465533 13:50711625-50711647 TGAAAAACAGAACATTCACGTGG - Intronic
1109617612 13:64856219-64856241 TGAGAGACAGCACAGACATGTGG - Intergenic
1109619091 13:64877391-64877413 AGAACACCCACACAGTCATGGGG + Intergenic
1112018152 13:95348568-95348590 TGGACAACAGCAAAGGTATGGGG + Intergenic
1113505755 13:110814493-110814515 ACAACAGCAACACAGTCATGTGG + Intergenic
1114007211 14:18327588-18327610 TGAACAATAGCAATGTCATAAGG + Intergenic
1116742152 14:48769907-48769929 AGAACAAAATCACAGACATGTGG - Intergenic
1116742379 14:48773333-48773355 AGAACAAAACCACAGGCATGTGG + Intergenic
1117412817 14:55466171-55466193 TGAACTACACCTCACTCATGAGG - Intergenic
1123426019 15:20170757-20170779 TGAACCACAGCAGGATCATGTGG - Intergenic
1123535251 15:21177281-21177303 TGAACCACAGCAGGATCATGTGG - Intergenic
1124016969 15:25885739-25885761 TGAAAAACAGAACAGTTGTGTGG + Intergenic
1125210190 15:37205882-37205904 TGAAAAACAGCAGAGGCAAGAGG + Intergenic
1128738400 15:70066529-70066551 TAAAAAACCGCAGAGTCATGGGG + Intronic
1128767626 15:70260837-70260859 TGCACCACAGCGCAGTCCTGGGG + Intergenic
1129012442 15:72433843-72433865 TGCACAACATCTCAGTCATTAGG - Intergenic
1131175119 15:90204421-90204443 TGATGAACAGCACATTCCTGGGG + Intronic
1134041548 16:11072667-11072689 TAATCAACAGAACAGTCCTGAGG - Intronic
1134116377 16:11551957-11551979 AAAACAACAGCAGAGTCCTGTGG + Intronic
1136858235 16:33678761-33678783 TGAACCACAGCAGGATCATGTGG + Intergenic
1139148039 16:64345876-64345898 TGAACAACAGAACAGTTCTCAGG - Intergenic
1139924032 16:70475868-70475890 CCAACAGCAGCACAGTCTTGTGG - Intronic
1141007362 16:80364792-80364814 TGGACAACCCCACAGTCAAGGGG - Intergenic
1203119804 16_KI270728v1_random:1527231-1527253 TGAACCACAGCAGGATCATGTGG + Intergenic
1143652258 17:8270654-8270676 TGTACAACAGAACAGTCATGAGG - Intergenic
1147424491 17:40339517-40339539 TGGGCAACAGCAAGGTCATGGGG - Intronic
1147488554 17:40842193-40842215 TGAACACCAACACAATCATAAGG - Intergenic
1150328435 17:64275220-64275242 TGAGTAACAGCAGAGGCATGAGG - Intergenic
1151145368 17:72035505-72035527 TAGAGAACAGCACACTCATGGGG - Intergenic
1151832767 17:76564966-76564988 TGATCAACAGAACAGACATTTGG - Intronic
1155636628 18:27963767-27963789 TGAAAAACAGCAGTGTGATGAGG + Intronic
1157007272 18:43598518-43598540 TAAACTCCAGCACAGTCACGTGG - Intergenic
1163258689 19:16173480-16173502 TGAACCACAGCCCAGACTTGGGG + Exonic
925041304 2:733375-733397 TGAACATCACAACAGTCATGGGG - Intergenic
925917384 2:8616293-8616315 TGAACAAGAGCAAAGTCACAGGG + Intergenic
926592926 2:14758886-14758908 AGAACAACAGCAGAGGCAAGGGG + Intergenic
926991992 2:18690104-18690126 TGAACAAAAGCACATGCAGGAGG - Intergenic
928047164 2:27947322-27947344 TGAACACTAGAACAGCCATGGGG - Intronic
928239517 2:29574397-29574419 AGAACACCAGCACAGACAGGTGG - Intronic
929495241 2:42435643-42435665 TGACCAACAGCATTGTCATTAGG + Intergenic
930606536 2:53498900-53498922 TGAACACCAGCATAGTCATGGGG - Intergenic
931084935 2:58819434-58819456 TGTAGAACAGAACAGTAATGAGG - Intergenic
938529359 2:132167877-132167899 TGAACAATAGCAATGTCATAAGG - Intronic
939117818 2:138080661-138080683 CGTACAAAAGGACAGTCATGGGG - Intergenic
940612609 2:156009362-156009384 TGAATAACAGCACAGGCAAGTGG + Intergenic
947015577 2:225616196-225616218 AGAACAACAGCTCAGTCATTTGG - Intronic
947962812 2:234253781-234253803 TTAACAACAGCACAGGGCTGTGG - Intergenic
948153927 2:235765799-235765821 TGAACACCAACATAGTCATCTGG + Intronic
948570774 2:238915829-238915851 TGAACCCCAGCACAGCCTTGTGG + Intergenic
949039647 2:241841997-241842019 TGACCAACATCAGAGTCCTGCGG - Intergenic
1168968146 20:1912683-1912705 TCCACCCCAGCACAGTCATGAGG - Intronic
1168969985 20:1924421-1924443 TGAACCACAGAGCGGTCATGAGG - Intronic
1171387004 20:24777167-24777189 AAAGCAACTGCACAGTCATGTGG + Intergenic
1173202627 20:40965419-40965441 TTCACAACAGCAAAGACATGAGG - Intergenic
1173677349 20:44848032-44848054 TCAACAACAGCAATGTGATGGGG + Intergenic
1174997584 20:55587849-55587871 TTAATCACAGCTCAGTCATGTGG + Intergenic
1175005739 20:55680445-55680467 TGAACAACTGAAAAATCATGAGG - Intergenic
1176520421 21:7820028-7820050 GCCACAAAAGCACAGTCATGAGG - Intronic
1177489280 21:21801357-21801379 TGGATAACACCAAAGTCATGAGG - Intergenic
1178654444 21:34450040-34450062 GCCACAAAAGCACAGTCATGAGG - Intergenic
1180431718 22:15258395-15258417 TGAACAATAGCAATGTCATAAGG + Intergenic
1180514276 22:16126303-16126325 TGAACAATAGCAATGTCATAAGG + Intergenic
1182634479 22:31713659-31713681 TGAAAAACAGCAGAGCCCTGAGG - Exonic
1183136610 22:35895022-35895044 AGAACAACAGAACAGTCAGCTGG - Intronic
1183197646 22:36364486-36364508 TGAGCCACACCATAGTCATGTGG - Intronic
954018955 3:47721661-47721683 TCAAAAACAGCACAGGTATGAGG - Intronic
955648939 3:61172073-61172095 TGAGCAAAATCAAAGTCATGGGG + Intronic
956230757 3:67013693-67013715 TGAATGACAGCAATGTCATGAGG - Intergenic
958516988 3:95129644-95129666 TGAATAGCAGCACTATCATGTGG + Intergenic
958575053 3:95938165-95938187 TAAACAAAAGTACAGTCAAGTGG - Intergenic
958602797 3:96319494-96319516 TGAAGAACAGCACACAAATGTGG - Intergenic
959248392 3:103905332-103905354 TGAGCTACAGTACAGTAATGAGG + Intergenic
961172292 3:124806127-124806149 TTGACAACAGCACAGTCATGCGG - Intronic
965073932 3:163953164-163953186 TGAACAACAGAACAGTTCTCGGG + Intergenic
968032672 3:195514487-195514509 TAAACAAAACCAAAGTCATGGGG + Exonic
971370747 4:26016751-26016773 TTAACATCATCACAGTCATTGGG - Intergenic
971490904 4:27211291-27211313 TGAAAAACAGCACAGTTTTGAGG + Intergenic
971736719 4:30462585-30462607 TGAACATCAGCAAAATCATATGG - Intergenic
975715125 4:77198086-77198108 TGATCAACAGGACAGTCAAAGGG + Intronic
975822166 4:78282784-78282806 TGAAGAACAGCATTGTCATCAGG - Intronic
975907718 4:79234562-79234584 TGAACAAAAGCAAAGCAATGTGG - Intronic
976720404 4:88163824-88163846 TGAACAACTGCACACAGATGCGG - Intronic
980007718 4:127560161-127560183 TTAGCCACTGCACAGTCATGCGG - Intergenic
984696615 4:182785858-182785880 TGAACAAAAGAACAGACAAGGGG - Intronic
985771098 5:1811667-1811689 TCAACAACACTACAGTGATGCGG - Intronic
989136932 5:38165322-38165344 TCAACACCAGCACAGGCAAGGGG + Intergenic
990663904 5:58050659-58050681 TGAGAAACAACACAGTAATGAGG + Intergenic
994582354 5:101660219-101660241 TGAACAACAATATAGTTATGAGG - Intergenic
995774352 5:115709710-115709732 TGAGCAACAGCAGTGTTATGTGG + Intergenic
996142267 5:119926408-119926430 TGCACAACAGCACTGTCAGGAGG - Intergenic
999970298 5:156853559-156853581 TAAACAAAATCAAAGTCATGGGG - Intergenic
1000776443 5:165425838-165425860 TAGACTCCAGCACAGTCATGTGG - Intergenic
1001269721 5:170302198-170302220 TGACCCACAGCAGAATCATGTGG + Intergenic
1002375799 5:178788423-178788445 TGATCACCATCAGAGTCATGAGG - Intergenic
1003839087 6:10101749-10101771 TGCACAACAGCACATACATGTGG + Intronic
1004006138 6:11638784-11638806 TGAACACCATCACAGAGATGGGG - Intergenic
1007989122 6:46236924-46236946 ATAACAACAGCTCTGTCATGTGG + Intronic
1008028089 6:46661732-46661754 AGAATGACAGCACTGTCATGAGG + Intronic
1011945441 6:92895616-92895638 TGAAGAACAGCAGATACATGAGG + Intergenic
1013366713 6:109442680-109442702 TGAACAAGGCCCCAGTCATGGGG + Intronic
1013968785 6:115989706-115989728 TGCACAATAGCAAGGTCATGTGG - Intronic
1015232617 6:130933750-130933772 CAAATAACAGCACAGGCATGGGG - Intronic
1018115159 6:160576018-160576040 TGAAATACAGCACACTTATGGGG + Intronic
1018218855 6:161558866-161558888 AGAAAAACAGCAGGGTCATGGGG - Intronic
1019991311 7:4693646-4693668 TGGAGAACAGCAGAGTGATGGGG + Intronic
1023291146 7:38670318-38670340 GGGTCAACAGCAAAGTCATGTGG + Intergenic
1024286175 7:47759621-47759643 TGAACAACAGACCATTCATATGG - Intronic
1026518779 7:71096804-71096826 TGAACAAAACCACAGTCCAGAGG - Intergenic
1028054494 7:86225727-86225749 TGAGCAACAGTACAGCCCTGAGG + Intergenic
1029029755 7:97455136-97455158 TGAACTAAAGCACAGTTATTAGG - Intergenic
1029321188 7:99761953-99761975 TAATCTACAGGACAGTCATGTGG - Intronic
1030813771 7:114008559-114008581 TTAAAAACAGAACTGTCATGTGG + Intronic
1032308029 7:130755109-130755131 TGAAAAGAAGCACAGTCCTGTGG - Intergenic
1033495258 7:141887554-141887576 TGAACAGCAGCACCTTCATTTGG + Intergenic
1034064999 7:148127761-148127783 AGAACAACAGCCCAGTTAAGTGG - Intronic
1035609822 8:953628-953650 TGGACAAAACCACAGTCATTGGG - Intergenic
1040819927 8:51545271-51545293 TGAAAAACATCACAGTGATAAGG + Intronic
1042334765 8:67618425-67618447 TCAACTACAGCACAGTACTGGGG + Intronic
1042938289 8:74082371-74082393 TGGACATGACCACAGTCATGAGG - Intergenic
1045693422 8:104782522-104782544 TGAGAAACAGCACAGGCATGAGG - Intronic
1047118759 8:121876166-121876188 TGAACAAAAGTATAGACATGGGG + Intergenic
1049655252 8:143794348-143794370 TGAACAACAGCACAGTCATGGGG - Intronic
1053707960 9:40774150-40774172 TGAACAATAGCAATGTCATAAGG - Intergenic
1054298327 9:63350375-63350397 TCAACAACAGCACACTTCTGTGG + Intergenic
1054417871 9:64894939-64894961 TGAACAATAGCAATGTCATAAGG - Intergenic
1055208751 9:73763720-73763742 TTCACAACAGCAAAGACATGGGG + Intergenic
1056117705 9:83457421-83457443 TGAAGGACAGGACAATCATGGGG - Intronic
1056553963 9:87673971-87673993 TGAGCAACAACACAGTCCTCAGG - Intronic
1058288204 9:103206169-103206191 TGATCAACAGAACAGACATTTGG - Intergenic
1058439484 9:104993704-104993726 TGAGCAGCAACACAGTCTTGGGG - Intergenic
1058882760 9:109299812-109299834 TGAACTTCAGCACAGGCAGGAGG - Intronic
1059936337 9:119314944-119314966 TGAACAAAAACACTGTCATAGGG - Intronic
1060129202 9:121078539-121078561 TGAACTAGAGGACAGTCCTGTGG - Intronic
1060881175 9:127119202-127119224 TGAGCCTCAGCACAGTTATGAGG - Intronic
1188357553 X:29211359-29211381 TAAGCAACAGCACAGTCAAGAGG - Intronic
1188809250 X:34632479-34632501 TGAAATACAGCAAATTCATGAGG + Intronic
1189555572 X:42141951-42141973 TGAGCATAAGCACAGCCATGTGG + Intergenic
1191648924 X:63514795-63514817 TTAACATCAGCACAGTTATTAGG - Intergenic
1192704824 X:73518621-73518643 TTATCCACAGCAAAGTCATGGGG - Intergenic
1197025411 X:121742579-121742601 GGAACAAAAACACAGTTATGAGG - Intergenic
1197102530 X:122673276-122673298 TGAACACCAGCACAGTATTTGGG - Intergenic
1199362733 X:146942341-146942363 TGGAAAACAGCACAGTGAAGAGG + Intergenic
1200403569 Y:2785270-2785292 CGACCAACAGCACAGCAATGAGG + Intergenic
1201146825 Y:11069297-11069319 TGGAAAGCAGCACAGGCATGAGG + Intergenic