ID: 1049655257

View in Genome Browser
Species Human (GRCh38)
Location 8:143794361-143794383
Sequence CTGTTGTTCATGAGGATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049655249_1049655257 3 Left 1049655249 8:143794335-143794357 CCCTGACTGCTGCCCCCATGACT 0: 1
1: 0
2: 1
3: 23
4: 252
Right 1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG No data
1049655250_1049655257 2 Left 1049655250 8:143794336-143794358 CCTGACTGCTGCCCCCATGACTG 0: 1
1: 0
2: 0
3: 16
4: 229
Right 1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG No data
1049655248_1049655257 21 Left 1049655248 8:143794317-143794339 CCTCAGGGCTCAGTGGCGCCCTG 0: 1
1: 0
2: 5
3: 38
4: 270
Right 1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG No data
1049655247_1049655257 22 Left 1049655247 8:143794316-143794338 CCCTCAGGGCTCAGTGGCGCCCT 0: 1
1: 0
2: 0
3: 18
4: 219
Right 1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG No data
1049655251_1049655257 -9 Left 1049655251 8:143794347-143794369 CCCCCATGACTGTGCTGTTGTTC 0: 1
1: 0
2: 2
3: 22
4: 245
Right 1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG No data
1049655252_1049655257 -10 Left 1049655252 8:143794348-143794370 CCCCATGACTGTGCTGTTGTTCA 0: 1
1: 0
2: 3
3: 13
4: 166
Right 1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049655257 Original CRISPR CTGTTGTTCATGAGGATGAA GGG Intronic
No off target data available for this crispr