ID: 1049656675

View in Genome Browser
Species Human (GRCh38)
Location 8:143802167-143802189
Sequence TGTCCTTGAGGGAGTCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 228}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049656675_1049656691 9 Left 1049656675 8:143802167-143802189 CCACCAGGACTCCCTCAAGGACA 0: 1
1: 0
2: 0
3: 29
4: 228
Right 1049656691 8:143802199-143802221 CCGGTGGGTGAGGGCTGGCCCGG No data
1049656675_1049656687 0 Left 1049656675 8:143802167-143802189 CCACCAGGACTCCCTCAAGGACA 0: 1
1: 0
2: 0
3: 29
4: 228
Right 1049656687 8:143802190-143802212 GGAGGGGACCCGGTGGGTGAGGG No data
1049656675_1049656685 -6 Left 1049656675 8:143802167-143802189 CCACCAGGACTCCCTCAAGGACA 0: 1
1: 0
2: 0
3: 29
4: 228
Right 1049656685 8:143802184-143802206 AGGACAGGAGGGGACCCGGTGGG No data
1049656675_1049656684 -7 Left 1049656675 8:143802167-143802189 CCACCAGGACTCCCTCAAGGACA 0: 1
1: 0
2: 0
3: 29
4: 228
Right 1049656684 8:143802183-143802205 AAGGACAGGAGGGGACCCGGTGG No data
1049656675_1049656693 11 Left 1049656675 8:143802167-143802189 CCACCAGGACTCCCTCAAGGACA 0: 1
1: 0
2: 0
3: 29
4: 228
Right 1049656693 8:143802201-143802223 GGTGGGTGAGGGCTGGCCCGGGG No data
1049656675_1049656686 -1 Left 1049656675 8:143802167-143802189 CCACCAGGACTCCCTCAAGGACA 0: 1
1: 0
2: 0
3: 29
4: 228
Right 1049656686 8:143802189-143802211 AGGAGGGGACCCGGTGGGTGAGG No data
1049656675_1049656692 10 Left 1049656675 8:143802167-143802189 CCACCAGGACTCCCTCAAGGACA 0: 1
1: 0
2: 0
3: 29
4: 228
Right 1049656692 8:143802200-143802222 CGGTGGGTGAGGGCTGGCCCGGG No data
1049656675_1049656688 4 Left 1049656675 8:143802167-143802189 CCACCAGGACTCCCTCAAGGACA 0: 1
1: 0
2: 0
3: 29
4: 228
Right 1049656688 8:143802194-143802216 GGGACCCGGTGGGTGAGGGCTGG No data
1049656675_1049656683 -10 Left 1049656675 8:143802167-143802189 CCACCAGGACTCCCTCAAGGACA 0: 1
1: 0
2: 0
3: 29
4: 228
Right 1049656683 8:143802180-143802202 CTCAAGGACAGGAGGGGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049656675 Original CRISPR TGTCCTTGAGGGAGTCCTGG TGG (reversed) Intronic
900140779 1:1138772-1138794 TGTGCTTGGGGGAGGTCTGGGGG + Intergenic
900179331 1:1304411-1304433 TGTCCCTGAGGGACTCCCAGCGG - Intronic
900561616 1:3309861-3309883 CCCCCTTGAGGGAGTCCTTGAGG + Intronic
900663101 1:3795858-3795880 TGACCTTGAGCGAGGCCAGGTGG + Exonic
901749677 1:11397995-11398017 TGTCTTTCAAGGAATCCTGGAGG + Intergenic
901766415 1:11502609-11502631 TGACCTTGAGGGAGGGTTGGTGG + Intronic
902808591 1:18875654-18875676 TGTCCTGGAGGGAACCCAGGAGG - Intronic
906713856 1:47952563-47952585 TGTCAGGGAAGGAGTCCTGGAGG - Intronic
907354492 1:53861317-53861339 TGTACCTGAGGGAGAACTGGAGG - Intronic
908657302 1:66401863-66401885 TCTCCTAAATGGAGTCCTGGTGG + Intergenic
910093727 1:83496066-83496088 TGTCCTTAAGGGAGTCTTCCTGG - Intergenic
911711598 1:101079640-101079662 TGTTCTTGAGAGACTCCTGGTGG - Intergenic
912246437 1:107965454-107965476 TGTTGTTTAGGGGGTCCTGGGGG - Intergenic
912565546 1:110584897-110584919 TATCTTTGGGGGAGTTCTGGAGG + Intergenic
912916386 1:113818924-113818946 TGTGATTCAGGGACTCCTGGAGG + Intronic
913463203 1:119111717-119111739 TGTAATTGAGGAACTCCTGGAGG - Intronic
914259236 1:145985051-145985073 TGACTGTGAGGGAGGCCTGGAGG - Intergenic
915282770 1:154833812-154833834 TGTCCTTGAATGAGGCATGGAGG - Intronic
916991898 1:170253518-170253540 TGTGCATGTGGGAGTGCTGGAGG + Intergenic
917274037 1:173311660-173311682 TGTCCATGAGGAAGTTCTGTGGG + Intergenic
918046408 1:180944222-180944244 TGTCCTTGAGTAAGTCATGGTGG + Intronic
918223931 1:182461517-182461539 TGTCCTTGAGAGAGCTCTGATGG + Intronic
920099871 1:203510379-203510401 TGCCCTTGAGGGAGTGTTGGAGG + Intergenic
920254739 1:204646882-204646904 TGTCCTTGAGCAAGTGGTGGAGG - Intronic
921159673 1:212464127-212464149 TGTCCTTGAGGGAGGGAAGGAGG - Intergenic
921164209 1:212494436-212494458 GATCCTTGAGGAAGTCCTGCTGG + Intergenic
922050972 1:221990404-221990426 GGCCCCTGAGGGAGCCCTGGTGG - Intergenic
1065241387 10:23708606-23708628 AGGCCTTGAGGCAGTCCTTGCGG + Intronic
1067084748 10:43231819-43231841 TGTCCTGCAGGGAGGGCTGGTGG + Intronic
1067233535 10:44427887-44427909 TGGCATTGAGGGAGACCAGGAGG - Intergenic
1070390684 10:75967886-75967908 TGTTCTTGAGGGAGGTCAGGAGG + Intronic
1071841002 10:89470902-89470924 TGTCCTTGTGGTAGTGGTGGGGG - Intronic
1073383291 10:103098969-103098991 TTTCCTTAAGGGAGCCCTGGAGG + Exonic
1074937783 10:118203109-118203131 TGAGCTTAAGGGAGTCTTGGAGG - Intergenic
1077132215 11:978795-978817 TGTCCTTCAGGGAGGTCTTGTGG + Intronic
1077391863 11:2303992-2304014 GGGCCGTGAGGGACTCCTGGGGG - Intronic
1077530468 11:3092530-3092552 TGTCCTTCAGGGGGTCCCAGGGG + Exonic
1079032953 11:16999143-16999165 TGTCCCTGAGCTGGTCCTGGGGG - Intronic
1080039675 11:27746247-27746269 TGTCCTTATGGGAGTACTGGGGG + Intergenic
1082972284 11:59036487-59036509 GGTCCTTCAGGGGGTCATGGTGG - Intronic
1082976755 11:59080371-59080393 GGTCCTTCAGGGGGTCATGGTGG - Intergenic
1083709765 11:64540890-64540912 GGTCCTGGAGGGAAGCCTGGTGG - Intergenic
1084298684 11:68230825-68230847 TATGCTTAAGGGAGTCCTGAAGG - Intergenic
1085197328 11:74680536-74680558 TGCCCTTGAGGGAGGTCAGGTGG + Intergenic
1088812318 11:113400057-113400079 TGCCCTTGAGGGCGGCCAGGTGG - Exonic
1089655502 11:119944118-119944140 TGTCCTTCAGAGAGCCCTGGAGG + Intergenic
1090947998 11:131448670-131448692 TGTCCTTGAGGCACTCCTCCAGG + Intronic
1091039339 11:132262160-132262182 TGCCCTGGAGAGACTCCTGGGGG - Intronic
1091599356 12:1908599-1908621 TGTCCGTGACGCAGTCCTGGGGG - Intronic
1092260464 12:6950975-6950997 TGTCATCGAGTGAGTCCTGCTGG - Intronic
1095142649 12:38685566-38685588 TGGCATTGAGGGGGTCATGGAGG - Exonic
1095294898 12:40516491-40516513 TGTCATAGATGGACTCCTGGAGG - Intronic
1097820876 12:64128086-64128108 TCTTCTTGAGGGAGTCGTGCCGG - Exonic
1101531216 12:105575186-105575208 TGTCCTTGAGAGAGTGCATGGGG + Intergenic
1103641374 12:122355240-122355262 TCTCCTTCAGGGCCTCCTGGAGG + Exonic
1103746980 12:123131619-123131641 TGTCCTGGAGGGATTCCAGATGG - Intronic
1104866649 12:131959947-131959969 TGCAGTTGAGGTAGTCCTGGAGG + Intronic
1104880778 12:132068900-132068922 TGTGCTTGAGGGAGCAGTGGAGG + Intronic
1104993774 12:132641720-132641742 TGTCCTCCAGGGAGGCCTGCTGG + Exonic
1106367949 13:29101586-29101608 TGTCCCTGAGGAAGATCTGGAGG + Intronic
1106797763 13:33224471-33224493 TGTCCTTGAGGGAGTAATATGGG - Intronic
1107527482 13:41247674-41247696 TTTCCTAGAGGCAGTTCTGGTGG + Intronic
1109222380 13:59653469-59653491 TGTCCTTCAGATAATCCTGGAGG + Intergenic
1110170266 13:72492027-72492049 TGTCTTTGGGGGAATCCTGTGGG + Intergenic
1111008159 13:82276506-82276528 TGTGCTTGAGGGAGTCAGAGTGG - Intergenic
1115648238 14:35384887-35384909 TGTTCTTGAGGGGCTCCAGGCGG + Intergenic
1116145390 14:41061432-41061454 TGGCCTGGTGGGAGGCCTGGTGG + Intergenic
1117557156 14:56897264-56897286 AGTACTTGAGGGAGAACTGGGGG + Intergenic
1118286545 14:64479508-64479530 TGTCCGTGAGGGTGTTCTGGAGG + Exonic
1118907275 14:70032018-70032040 TGTCCTGGAGAAAGTCCTAGAGG + Intronic
1120069151 14:80083367-80083389 TGTCCTTAAGGGAGTTCTTGGGG + Intergenic
1120174193 14:81276186-81276208 TGTGCTTGAGTGAGTCCAGAAGG - Intronic
1120824281 14:88941325-88941347 TCTCCTTGAGGAAGCCCTTGAGG - Intergenic
1122359924 14:101153084-101153106 GGGCCTGGAGGGAGGCCTGGGGG - Intergenic
1122578059 14:102754339-102754361 TGTCCTTGAGTGACTCTTCGGGG - Intergenic
1122647675 14:103206124-103206146 TGACCTTGAGCAAGGCCTGGAGG + Intergenic
1123123229 14:105927663-105927685 ATTCCTAGAGGGAGCCCTGGTGG - Intronic
1123405882 15:20019163-20019185 ATTCCTAGAGGGAGCCCTGGTGG - Intergenic
1123515212 15:21025811-21025833 ATTCCTAGAGGGAGCCCTGGTGG - Intergenic
1125334035 15:38610083-38610105 TTCCCTTGAGGGAGTCTTGAAGG + Intergenic
1128078625 15:64843157-64843179 TGGCCTAGAGGGAGCCCTGACGG - Intronic
1128349797 15:66881262-66881284 TGTCCTGGGGGCAGTGCTGGGGG + Intergenic
1128495460 15:68195935-68195957 TGTCCTGGGGGGAGTCTGGGAGG + Intronic
1130569394 15:85027131-85027153 AGGCCTTCAGGGAGTCCTGGAGG - Intronic
1132870602 16:2114169-2114191 TGTACTGCAGGGAGTCCTAGTGG - Exonic
1132931739 16:2462250-2462272 TGGGCTTGTGGGAGCCCTGGGGG + Intronic
1133731131 16:8579473-8579495 TGTCCTTGAGTCTGTCCTGGAGG + Intronic
1136177582 16:28528524-28528546 TGGCCTTCAGGGAGTCCCAGGGG - Intergenic
1136298368 16:29316741-29316763 TGACCTGGAGGTAGTCCTGCAGG + Intergenic
1136509629 16:30728959-30728981 TTTCCTCCAGGGAGTCCTGGGGG - Exonic
1140259248 16:73363080-73363102 TGACATTGTGTGAGTCCTGGTGG + Intergenic
1141134314 16:81455827-81455849 TTCCCTTCAGGGAGGCCTGGTGG + Intronic
1141755364 16:85987469-85987491 TGGCCATGTGGGAGTCCAGGAGG + Intergenic
1141755761 16:85989544-85989566 TGGCCATGCGGGAGTCCAGGAGG + Intergenic
1142134030 16:88443538-88443560 TGTCCTTCAGGGAACCCTGCAGG - Intergenic
1143299914 17:5901642-5901664 TGTCCTTTGGGGAATCCTGGTGG - Intronic
1144101279 17:11944388-11944410 TGGCATTGAGGGGGTTCTGGAGG + Intronic
1148886131 17:50774319-50774341 ATTCCTTGAGGGAATCCTGGAGG + Intergenic
1151679127 17:75614629-75614651 GGACCTGGAGGGGGTCCTGGGGG - Intergenic
1151947481 17:77327494-77327516 GGTCCCTGAGGGGGTCCTGAAGG + Intronic
1152361543 17:79835335-79835357 TGTCAGTGGAGGAGTCCTGGAGG + Exonic
1152759828 17:82102003-82102025 TGGCCTTCACGGACTCCTGGAGG - Intronic
1153914509 18:9733785-9733807 TGTCTCTGAGGGAGTCTTGAGGG - Intronic
1157404449 18:47411313-47411335 TATCCTGGAGGGCTTCCTGGAGG + Intergenic
1157421551 18:47551537-47551559 TGTCCTTGGGGGCCTGCTGGAGG + Intergenic
1157604237 18:48915663-48915685 TGTCCCTGAGGGTGTGCTGGGGG - Intergenic
1158131155 18:54153793-54153815 TTTCCTTGAAGCAGTCCTGCTGG - Exonic
1158255177 18:55538282-55538304 TGTCTTTTAGGGGGTACTGGTGG - Intronic
1158571191 18:58598200-58598222 TGGCCTGAAGGGAGTCCTGGAGG + Intronic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1160839367 19:1138759-1138781 TGTCCGTGATGGAGGCGTGGAGG - Intronic
1160839376 19:1138795-1138817 TGTCCGTGATGGAGGCGTGGAGG - Intronic
1160839382 19:1138830-1138852 TGTCCGTGATGGAGGCGTGGAGG - Intronic
1161206884 19:3046274-3046296 TGCCCTTCAGGCAGTCTTGGGGG - Intronic
1161234267 19:3190171-3190193 AGACCTCGAGGGAGTCCTTGGGG - Intronic
1161578667 19:5068577-5068599 TGTCCTTGGGGGTGGCCGGGAGG + Intronic
1163416961 19:17192739-17192761 TCTCCTTCAGGAAGACCTGGTGG - Exonic
1163831800 19:19550590-19550612 TGTCCTTGAAGGCTGCCTGGCGG + Intergenic
1164497215 19:28777514-28777536 TGTGCTTGAGAGAGTCCGAGTGG - Intergenic
1164552148 19:29220880-29220902 TGTCCTCCAGGAAGCCCTGGTGG + Intergenic
1165726931 19:38119474-38119496 GGTCCTTGAGATACTCCTGGCGG - Exonic
1165739852 19:38198578-38198600 TGTTCTAGAGGGATTCATGGAGG + Intronic
1167117790 19:47498148-47498170 CCTTCTGGAGGGAGTCCTGGAGG + Intronic
1167517384 19:49930973-49930995 GGTCCTTGGGGGAGCCCTGGAGG + Exonic
1167563367 19:50239999-50240021 TTACCTTGAGGGGGTGCTGGTGG - Intronic
1168228748 19:55015207-55015229 TGGCTTGGAGGGGGTCCTGGAGG - Intronic
1168323881 19:55528156-55528178 TGTCCTGCAGGGGGTCCTGATGG - Intergenic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
1168644900 19:58053604-58053626 TGTGCTTGAGGGATGGCTGGTGG - Exonic
925421582 2:3717221-3717243 TGACTTTGAGAGAGACCTGGGGG - Intronic
925885494 2:8390962-8390984 TGTACTGGAGGGAGTTCTAGGGG + Intergenic
926350263 2:11987531-11987553 TTTCCATGAGGGAGACATGGAGG + Intergenic
927154619 2:20214358-20214380 TGTCCCTGAAGGAGTCCCAGGGG + Intronic
928361284 2:30664152-30664174 TGTTCTTGAAAGAGTCCTTGTGG + Intergenic
929567579 2:42999472-42999494 TGTCCATGAGGGATGCATGGAGG - Intergenic
929595050 2:43170533-43170555 TCTCCTTGAGGGGCTCCAGGTGG - Intergenic
933835030 2:86239124-86239146 TGACCTTGAGTGAGTGCTGTGGG - Intronic
937349817 2:121153704-121153726 GGTCAGTGAGGGGGTCCTGGAGG + Intergenic
938910568 2:135881987-135882009 TGTCTTTGAGGGGTTTCTGGAGG + Intergenic
938986708 2:136583573-136583595 TGTCCTGAAGGGACTCATGGTGG + Intergenic
940512720 2:154639420-154639442 TGTCCTTGAGGATAACCTGGAGG + Intergenic
941233800 2:162944332-162944354 AGTCCTTCAGTGAGACCTGGAGG + Intergenic
942016276 2:171820065-171820087 TCTACTTGAGGGAGGACTGGAGG + Intronic
942957602 2:181791789-181791811 TGTTCATGAAGGAGTCCTAGTGG + Intergenic
943564608 2:189503078-189503100 CTTCCTTCAGGGAGACCTGGTGG + Intergenic
946491886 2:220156560-220156582 TGTCCTTGTGGGATTAGTGGAGG - Intergenic
948604501 2:239126347-239126369 TGACCTTAAGGGAGGCCAGGAGG - Intronic
948847598 2:240690583-240690605 GGTGCTGGAGTGAGTCCTGGGGG + Intergenic
948886325 2:240886948-240886970 TCTCCTTGAGGGGGTAGTGGAGG - Exonic
1169059510 20:2651783-2651805 TGTCCTTGAGGGCGTCTTTTGGG - Intergenic
1170211994 20:13855081-13855103 GTTCCTTGAGGGATTCCTAGAGG + Intronic
1170874757 20:20240221-20240243 TGTGCAAGAGGAAGTCCTGGTGG + Intronic
1171291276 20:23984378-23984400 AGGCCCTGAGGGAGGCCTGGAGG + Intergenic
1172529133 20:35618286-35618308 TGTGCTTGAGGGTCTCTTGGGGG + Intronic
1175379957 20:58556136-58556158 TCTCCTTTGGGGAGTCCTTGAGG + Intergenic
1175629607 20:60524026-60524048 TGTTCTTTGGTGAGTCCTGGAGG - Intergenic
1175895936 20:62335588-62335610 TACCCATGAGGGTGTCCTGGAGG - Intronic
1175895999 20:62335820-62335842 AGTCCATGAGGGTGTCCTGGAGG - Intronic
1176131447 20:63498422-63498444 TGTCCCTGTGAGAGTCCGGGAGG - Intronic
1176144238 20:63558419-63558441 TGTCCTTCAGGGGCTGCTGGAGG - Intronic
1176258988 20:64169120-64169142 GGTCCCTGAGGGAGACATGGAGG - Intronic
1178308381 21:31509388-31509410 GGCCCTTGAGTGGGTCCTGGGGG - Intronic
1179731139 21:43367971-43367993 TGTCCCTGGGGGATTGCTGGGGG - Intergenic
1181702664 22:24629655-24629677 AGGCCCTGAGGGAGGCCTGGAGG - Intergenic
1182063930 22:27417139-27417161 TGTCTTTGAGAGGGTGCTGGTGG - Intergenic
1183332636 22:37229630-37229652 AGGCCTAGGGGGAGTCCTGGGGG - Intronic
1183343256 22:37293735-37293757 TGTCCTTCAGGGGGTGCTGGTGG + Intronic
1185020270 22:48370456-48370478 AGGCCTTGAGTGGGTCCTGGAGG - Intergenic
1185266264 22:49905967-49905989 GGGCCTTGAGACAGTCCTGGGGG - Intronic
950531879 3:13556924-13556946 GGGGCGTGAGGGAGTCCTGGTGG - Intronic
954370959 3:50169394-50169416 TGGCCATGAGAGAGTCCTGGAGG + Intronic
954430232 3:50466937-50466959 TGATCTGGAGGGATTCCTGGAGG + Intronic
956354143 3:68372263-68372285 TGTTCTTCAGAGATTCCTGGGGG - Intronic
957406553 3:79779657-79779679 AGTCCCTGTGGGACTCCTGGTGG - Intergenic
958074061 3:88654078-88654100 AGTACTTGAGGCAGCCCTGGCGG + Intergenic
958087634 3:88832075-88832097 TGTCCTTGTAGGTTTCCTGGGGG - Intergenic
961006685 3:123410267-123410289 TGCCCTGGAGGGAGTCTTTGTGG - Intronic
961815513 3:129548161-129548183 GGTCCCTGAGGTATTCCTGGTGG - Intronic
962422682 3:135241944-135241966 TTCCCTTGAGGGCATCCTGGGGG - Intronic
963093680 3:141511861-141511883 AGTCCTTGAGGTAGCACTGGTGG + Intronic
964419536 3:156486681-156486703 TGCCCTTCAGGGCCTCCTGGAGG + Intronic
965733112 3:171792975-171792997 TCTCCTTCAGGTATTCCTGGTGG - Intronic
967307431 3:188072678-188072700 TGTTTTTGTGGTAGTCCTGGTGG - Intergenic
967653013 3:192009554-192009576 TTTTCTAGAGGGAGTACTGGAGG + Intergenic
968578584 4:1379257-1379279 TGTCCTAGAAGGAGGCCTGGTGG + Intronic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969365058 4:6689552-6689574 TGTCCTTGGGCGAGTGCTGCGGG + Intergenic
969592069 4:8127684-8127706 TGACCTTGTGGGAGCCCTGTGGG - Intronic
973845998 4:54913982-54914004 TGCCCTTGAAGGCGTCCTGGTGG + Intergenic
978829734 4:113069790-113069812 AGTCCTTGCGGGAGGCCAGGAGG - Intronic
986743014 5:10720229-10720251 TGGGCTTGAGGAAGTCCTGAAGG - Intronic
987042272 5:14074220-14074242 TTTCCTTTAGGAAGGCCTGGTGG - Intergenic
987183109 5:15386680-15386702 TGTTCTTGAGAAACTCCTGGAGG + Intergenic
987942843 5:24564580-24564602 TGTCCTGGAGGGGGCCGTGGGGG - Intronic
991482497 5:67096541-67096563 TGTGCTTAATGGAGTGCTGGGGG - Intronic
997196905 5:131986284-131986306 TGAGCTGGAGGGAGGCCTGGAGG + Intronic
997263161 5:132478973-132478995 TGTCCTCCAGGCAGTCCTGTTGG - Intergenic
998081097 5:139275407-139275429 TGTCCTTCAGGAAGTATTGGAGG + Intronic
999734164 5:154500165-154500187 TGTCCACAAGGGACTCCTGGAGG - Intergenic
999838206 5:155397398-155397420 TGCTCTTGAAGGAGTCCTGACGG + Intergenic
999933985 5:156465159-156465181 TTTCCTGGAGGGAATCCTAGAGG - Intronic
1001546233 5:172572184-172572206 TGTCCCTGTGGGAATTCTGGGGG + Intergenic
1002854141 6:1022685-1022707 TGCCCTTGAGGAAGGACTGGGGG + Intergenic
1003462163 6:6339641-6339663 TTTCCTTTAGGAATTCCTGGTGG + Intergenic
1005013594 6:21358068-21358090 TCTCCTTGAGGAAGTCCCCGTGG - Intergenic
1006604805 6:35248597-35248619 TGTACTTGAAGTAGTTCTGGGGG - Exonic
1007325387 6:41055511-41055533 ACTCCAGGAGGGAGTCCTGGGGG - Intronic
1007762045 6:44138953-44138975 TACCCTTGGGGGAGGCCTGGGGG - Intronic
1019737084 7:2655991-2656013 TGGGCTGGAGGGAGACCTGGGGG + Intronic
1020110166 7:5443411-5443433 TGTCCTTGAGGGGCCCTTGGTGG + Intronic
1021378031 7:19932749-19932771 AGTCCTTGAGGACTTCCTGGTGG + Intergenic
1021608153 7:22430390-22430412 TGCACTTGTGGTAGTCCTGGTGG - Intronic
1023829329 7:44029691-44029713 TGTCCTTGTGGGAAGGCTGGGGG + Intergenic
1024995177 7:55268745-55268767 TCTCCTGGAGGGACTCCTGGAGG - Intergenic
1027800687 7:82745603-82745625 TGACCTTCAGGGAGTTATGGAGG + Intergenic
1029739635 7:102483949-102483971 TGTCCTTGTGGGAAGGCTGGGGG + Intronic
1029757636 7:102583128-102583150 TGTCCTTGTGGGAAGGCTGGGGG + Intronic
1029775572 7:102682189-102682211 TGTCCTTGTGGGAAGGCTGGGGG + Intergenic
1035290878 7:157837689-157837711 TGTCCTTGTGAGGGTCATGGAGG - Intronic
1035622424 8:1043988-1044010 CGTCCTTTGGGAAGTCCTGGGGG - Intergenic
1035646259 8:1223159-1223181 TGGCCTTGAGTGACTCCTAGGGG - Intergenic
1035648444 8:1246675-1246697 TGTACTTGAAGGACTCCTGGAGG + Intergenic
1036296777 8:7543696-7543718 TGCCCCTGGGTGAGTCCTGGAGG - Intergenic
1036325790 8:7777323-7777345 TGCCCCTGGGTGAGTCCTGGAGG + Intergenic
1036510373 8:9394447-9394469 TGTGCTCCAGGGAATCCTGGGGG - Intergenic
1036956221 8:13190986-13191008 TGTGTTTGGGGGAGTGCTGGGGG + Intronic
1037740445 8:21604768-21604790 TGTTCTCCAGGGAGGCCTGGAGG + Intergenic
1038535085 8:28347914-28347936 TTTCCTCGAGGAACTCCTGGAGG - Exonic
1040470425 8:47731734-47731756 TCTCCTTGTCTGAGTCCTGGGGG + Intronic
1040899786 8:52406471-52406493 TGGCCTTGAAGGAGTCCTTGGGG + Intronic
1043000458 8:74753644-74753666 TGGCTTTCAGGTAGTCCTGGGGG - Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1046686992 8:117238767-117238789 TGTGAATGAGGGAGTCCTTGTGG - Intergenic
1047618744 8:126585200-126585222 CATCCTTGAGGGACTCCTCGTGG - Intergenic
1048557254 8:135491684-135491706 TGTCATTCAGGAAGCCCTGGAGG + Intronic
1048934767 8:139345707-139345729 TGTCCTTGAATGAGGCATGGAGG + Intergenic
1049264291 8:141659139-141659161 TGTCCTTGTGTGAGGCCTCGGGG + Intergenic
1049515166 8:143050598-143050620 TAACCTTGAGGGAGTCCAGGAGG - Intronic
1049656675 8:143802167-143802189 TGTCCTTGAGGGAGTCCTGGTGG - Intronic
1049704435 8:144034180-144034202 TGTTGTAGAGGGAGTGCTGGAGG + Intronic
1050642296 9:7681020-7681042 TGTCTTTGAGGGAGTCTCAGAGG - Intergenic
1052731453 9:32291213-32291235 TCTCCTTGAGTGGGTCCTGCTGG + Intergenic
1053392439 9:37745561-37745583 TGTCCTTGAGGGTCTCTAGGGGG - Exonic
1061042909 9:128150042-128150064 AGTCCAGAAGGGAGTCCTGGGGG - Intronic
1061045680 9:128163711-128163733 TGGCCTTCAGGGACCCCTGGTGG + Exonic
1061937679 9:133867254-133867276 CTTCCTGGAGGGAGGCCTGGTGG - Intronic
1062333597 9:136055290-136055312 TGTCCTTGTGTGAATCCTGCCGG - Intronic
1062454459 9:136629120-136629142 CGTCCTTGAGGGGCTGCTGGGGG - Intergenic
1187256750 X:17650146-17650168 TGACCTTGAGGGTGACCTCGAGG - Intronic
1187527375 X:20066343-20066365 TGTCCAGGAGGGAGGCCTGAAGG + Intronic
1188811290 X:34656853-34656875 TGTCGTTGTGGGAGTCCTGCCGG - Exonic
1189002098 X:36958068-36958090 TGTCGTTGTGGGAGTCCTGCCGG + Intergenic
1189363902 X:40373606-40373628 GGTCCTTGAAGGAGACGTGGGGG + Intergenic
1189662186 X:43311838-43311860 TGTGCTTGAGGGAGTTGTGGAGG - Intergenic
1189730512 X:44015386-44015408 GGTCCTGAAGGGAGCCCTGGGGG - Intergenic
1191951360 X:66597347-66597369 TGTCTTTGAGGGACTGCTGTGGG + Exonic
1192470453 X:71394316-71394338 TGTAATTGAGGGAGATCTGGAGG + Intronic
1198066916 X:133107230-133107252 TGTCCTTGGGGCATTCCTTGTGG + Intergenic