ID: 1049658957

View in Genome Browser
Species Human (GRCh38)
Location 8:143811246-143811268
Sequence GCCCGAGATCGGGGGCTGTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049658957_1049658968 17 Left 1049658957 8:143811246-143811268 CCACACAGCCCCCGATCTCGGGC 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1049658968 8:143811286-143811308 GTTCCGGTCCACGTTGAGGTTGG 0: 1
1: 0
2: 1
3: 6
4: 34
1049658957_1049658967 13 Left 1049658957 8:143811246-143811268 CCACACAGCCCCCGATCTCGGGC 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1049658967 8:143811282-143811304 GGTGGTTCCGGTCCACGTTGAGG 0: 1
1: 0
2: 0
3: 2
4: 40
1049658957_1049658963 -8 Left 1049658957 8:143811246-143811268 CCACACAGCCCCCGATCTCGGGC 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1049658963 8:143811261-143811283 TCTCGGGCGGCAGCGCCTCGAGG 0: 1
1: 0
2: 1
3: 11
4: 86
1049658957_1049658964 -5 Left 1049658957 8:143811246-143811268 CCACACAGCCCCCGATCTCGGGC 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1049658964 8:143811264-143811286 CGGGCGGCAGCGCCTCGAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 117
1049658957_1049658965 1 Left 1049658957 8:143811246-143811268 CCACACAGCCCCCGATCTCGGGC 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1049658965 8:143811270-143811292 GCAGCGCCTCGAGGTGGTTCCGG 0: 1
1: 0
2: 0
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049658957 Original CRISPR GCCCGAGATCGGGGGCTGTG TGG (reversed) Exonic