ID: 1049658959

View in Genome Browser
Species Human (GRCh38)
Location 8:143811254-143811276
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 38}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049658959_1049658965 -7 Left 1049658959 8:143811254-143811276 CCCCCGATCTCGGGCGGCAGCGC 0: 1
1: 0
2: 0
3: 5
4: 38
Right 1049658965 8:143811270-143811292 GCAGCGCCTCGAGGTGGTTCCGG 0: 1
1: 0
2: 0
3: 9
4: 111
1049658959_1049658968 9 Left 1049658959 8:143811254-143811276 CCCCCGATCTCGGGCGGCAGCGC 0: 1
1: 0
2: 0
3: 5
4: 38
Right 1049658968 8:143811286-143811308 GTTCCGGTCCACGTTGAGGTTGG 0: 1
1: 0
2: 1
3: 6
4: 34
1049658959_1049658967 5 Left 1049658959 8:143811254-143811276 CCCCCGATCTCGGGCGGCAGCGC 0: 1
1: 0
2: 0
3: 5
4: 38
Right 1049658967 8:143811282-143811304 GGTGGTTCCGGTCCACGTTGAGG 0: 1
1: 0
2: 0
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049658959 Original CRISPR GCGCTGCCGCCCGAGATCGG GGG (reversed) Exonic