ID: 1049658960

View in Genome Browser
Species Human (GRCh38)
Location 8:143811255-143811277
Sequence GGCGCTGCCGCCCGAGATCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049658960_1049658968 8 Left 1049658960 8:143811255-143811277 CCCCGATCTCGGGCGGCAGCGCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1049658968 8:143811286-143811308 GTTCCGGTCCACGTTGAGGTTGG 0: 1
1: 0
2: 1
3: 6
4: 34
1049658960_1049658967 4 Left 1049658960 8:143811255-143811277 CCCCGATCTCGGGCGGCAGCGCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1049658967 8:143811282-143811304 GGTGGTTCCGGTCCACGTTGAGG 0: 1
1: 0
2: 0
3: 2
4: 40
1049658960_1049658965 -8 Left 1049658960 8:143811255-143811277 CCCCGATCTCGGGCGGCAGCGCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1049658965 8:143811270-143811292 GCAGCGCCTCGAGGTGGTTCCGG 0: 1
1: 0
2: 0
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049658960 Original CRISPR GGCGCTGCCGCCCGAGATCG GGG (reversed) Exonic
900126834 1:1072465-1072487 GGGGCTGCCGGCCGAGCTGGGGG + Exonic
900558616 1:3292479-3292501 GACGCTGCGGCCCCAGATAGAGG - Intronic
906202674 1:43970208-43970230 GGCGCTGCAGCGAGAGACCGGGG + Exonic
906511268 1:46411630-46411652 GGAACTGCAGCACGAGATCGAGG + Exonic
910408552 1:86915210-86915232 GGCGCTGCCGCCGGAGCAAGTGG + Intronic
915238204 1:154501601-154501623 GGTGCTGCAGCCCGAGCTCTTGG + Exonic
1071086676 10:81874767-81874789 GGAGCAGCCGCCGAAGATCGCGG + Intergenic
1076760024 10:132599444-132599466 GGCGGAGCTGCCCAAGATCGTGG - Intronic
1079128535 11:17734956-17734978 GGCGCTGCCGGCCGAGACGGGGG - Exonic
1084028551 11:66467391-66467413 TGTGCTGCAGCCCGAGCTCGAGG + Intronic
1084330003 11:68424651-68424673 AGGGCTGAAGCCCGAGATCGAGG + Intronic
1090817811 11:130314523-130314545 GGCGCGGCGGCCCGAGATAGGGG - Exonic
1096529324 12:52233340-52233362 GGCGCCGCGGCCCGAGAAGGCGG - Exonic
1101356809 12:103986628-103986650 GCCTCTGCCTCCCGGGATCGAGG - Intronic
1102248355 12:111369042-111369064 GGCGCAGCCGCGGGAGAGCGCGG + Exonic
1112652639 13:101416098-101416120 GGCGCCTCCACCCGAGAGCGGGG - Intronic
1114070206 14:19099474-19099496 AGCGCTGCCGCCAGAGCTCCAGG - Intergenic
1114092058 14:19300528-19300550 AGCGCTGCCGCCAGAGCTCCAGG + Intergenic
1118186644 14:63543577-63543599 GGCTGCACCGCCCGAGATCGCGG - Intergenic
1122221053 14:100239286-100239308 GGAGATGCCGGCCGAGATCGTGG + Exonic
1122486682 14:102086852-102086874 AGCGCGGCCGCCCGGGAGCGCGG + Intronic
1127293731 15:57592060-57592082 GGCGGCGCCGCCCGAGAGCAGGG - Exonic
1128766329 15:70253249-70253271 GGGGCTGCCGCCCCAAAGCGAGG + Intergenic
1133006253 16:2883329-2883351 GGCGCTGTCGCCGGAGAGGGAGG + Exonic
1139402888 16:66696451-66696473 GCTGCTGGCGCCCGAGATCATGG + Exonic
1141957679 16:87383519-87383541 GGAGCTGCCGCCCGAGCTGCTGG - Exonic
1142890741 17:2940941-2940963 GGCGGTGCAGCCTGAGATTGGGG - Intronic
1146909957 17:36642022-36642044 GGCGCTGCCGGCCTCGAGCGAGG + Intergenic
1147369414 17:39981217-39981239 GTCGCTGTCACCCGCGATCGCGG - Intronic
1147666586 17:42152694-42152716 GCCTCTGCCTCCCGAGATCAAGG - Intronic
1148463906 17:47853152-47853174 GGAGATGCCGCCTGACATCGGGG + Intronic
1151825712 17:76523146-76523168 CGCGCTGCAGCCTGAGACCGAGG - Intergenic
1159948706 18:74463066-74463088 GGAGCTGCAGCCCAAGAACGTGG + Intergenic
1160434708 18:78838400-78838422 AGCGCTGCCAGCCGAGATGGAGG - Intergenic
1160918890 19:1510629-1510651 GGCGCTGCCTCCGGTGAGCGGGG - Exonic
1161215650 19:3094135-3094157 GGCGGGGCCGCCCGGGATTGTGG - Intergenic
1162106696 19:8374063-8374085 TGCGTTGCCTCCTGAGATCGAGG + Exonic
1162480237 19:10923371-10923393 GTCGCTGCCTCCGGAGAACGTGG - Exonic
1166838406 19:45681669-45681691 CGCGCTGCCGCCAGAGGGCGGGG - Intronic
1167429543 19:49446661-49446683 GGGGCTGTCGCTGGAGATCGGGG - Exonic
1167591998 19:50409188-50409210 GGGGCTGCTGCCCCAGATCCTGG + Exonic
1168078499 19:53992964-53992986 GGGGCTGACGCCCGAGCGCGAGG + Exonic
944457614 2:199911533-199911555 GCCGCTGCCGCCCGGGTTCATGG - Exonic
947624991 2:231613688-231613710 GACGCTGCCGGCCCAGATCCTGG - Intergenic
1175703151 20:61155074-61155096 GGCCCTGCCTCCCGGGATGGGGG + Intergenic
1176113062 20:63419213-63419235 GGAGCTGCCTCCCGCGGTCGAGG + Intronic
1176952669 21:15064962-15064984 GCCGCCGCCTCCCGAGTTCGGGG + Exonic
1179561609 21:42219279-42219301 GGCGGTGCCGACCGAGAAAGCGG - Exonic
1180488676 22:15822036-15822058 AGCGCTGCCGCCAGAGCTCCAGG - Intergenic
1181002030 22:19992341-19992363 GGGGCCGCCGCCCGAGACTGAGG + Intronic
1181934560 22:26429426-26429448 GACGCCGCCGCCCGAGGGCGCGG - Exonic
1183486198 22:38088942-38088964 GGCGCTGCCGCTGTAGAGCGAGG + Exonic
955195516 3:56801882-56801904 GCCGCCGCCGCCCGGCATCGTGG - Intronic
957123962 3:76133816-76133838 GGCGGTGCCCACCCAGATCGAGG + Intronic
958798681 3:98732698-98732720 GGCGCAGTCGCCCGGGATTGGGG + Exonic
961692605 3:128680862-128680884 GGCACTGCCGCCAGAGGGCGCGG + Intronic
968286196 3:197510249-197510271 CGCGCTGCCGCCCGAGCCTGAGG - Exonic
969115688 4:4869437-4869459 GGCGCTGCTGCCAGAGTTTGCGG + Intergenic
969268887 4:6085446-6085468 AGAGCTCCCGCCCGGGATCGGGG - Exonic
972396520 4:38663732-38663754 CGCGCCGCCGCCCGAGCCCGGGG - Intergenic
980920744 4:139083690-139083712 GCCGCTGCTGCCCGCGTTCGGGG - Intronic
985478277 5:91966-91988 GCCACTGCCGCCCGCGCTCGGGG + Intergenic
985894205 5:2739378-2739400 GGCGCTGGGGCCGCAGATCGGGG + Intergenic
990266992 5:54087376-54087398 GGAGCTGCAGCCCAAGATCTCGG - Intronic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
1002540411 5:179902833-179902855 GGCTCTGAAGCCAGAGATCGGGG + Intronic
1003872901 6:10415782-10415804 GGCGCTGCGGCCCGAGGGGGTGG - Intronic
1029496349 7:100897100-100897122 GGCGCCGCCGCCAGGGACCGCGG + Intergenic
1036454251 8:8893564-8893586 CGCGCTCCCGCCCGAGCCCGGGG - Exonic
1037273806 8:17156731-17156753 GGCGCTGCTGCCCGGGCCCGAGG - Exonic
1042235866 8:66613025-66613047 GGCGCTGCGGGCCGGGGTCGGGG - Exonic
1049368358 8:142251734-142251756 GGCCCTGCAGACAGAGATCGCGG - Intronic
1049389717 8:142361462-142361484 GGCGCTGCCTCCCAGGAGCGAGG + Intronic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1057741075 9:97711560-97711582 GGCGCTGCCGCCAGAGGAGGGGG + Intergenic
1062499531 9:136846309-136846331 GGCGCTGCCGGCCGAGGCGGGGG - Exonic