ID: 1049658961

View in Genome Browser
Species Human (GRCh38)
Location 8:143811256-143811278
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049658961_1049658968 7 Left 1049658961 8:143811256-143811278 CCCGATCTCGGGCGGCAGCGCCT 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1049658968 8:143811286-143811308 GTTCCGGTCCACGTTGAGGTTGG 0: 1
1: 0
2: 1
3: 6
4: 34
1049658961_1049658967 3 Left 1049658961 8:143811256-143811278 CCCGATCTCGGGCGGCAGCGCCT 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1049658967 8:143811282-143811304 GGTGGTTCCGGTCCACGTTGAGG 0: 1
1: 0
2: 0
3: 2
4: 40
1049658961_1049658965 -9 Left 1049658961 8:143811256-143811278 CCCGATCTCGGGCGGCAGCGCCT 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1049658965 8:143811270-143811292 GCAGCGCCTCGAGGTGGTTCCGG 0: 1
1: 0
2: 0
3: 9
4: 111
1049658961_1049658971 30 Left 1049658961 8:143811256-143811278 CCCGATCTCGGGCGGCAGCGCCT 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1049658971 8:143811309-143811331 TCAGCTTAGTCAGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049658961 Original CRISPR AGGCGCTGCCGCCCGAGATC GGG (reversed) Exonic