ID: 1049658962

View in Genome Browser
Species Human (GRCh38)
Location 8:143811257-143811279
Sequence GAGGCGCTGCCGCCCGAGAT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049658962_1049658971 29 Left 1049658962 8:143811257-143811279 CCGATCTCGGGCGGCAGCGCCTC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1049658971 8:143811309-143811331 TCAGCTTAGTCAGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 145
1049658962_1049658967 2 Left 1049658962 8:143811257-143811279 CCGATCTCGGGCGGCAGCGCCTC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1049658967 8:143811282-143811304 GGTGGTTCCGGTCCACGTTGAGG 0: 1
1: 0
2: 0
3: 2
4: 40
1049658962_1049658968 6 Left 1049658962 8:143811257-143811279 CCGATCTCGGGCGGCAGCGCCTC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1049658968 8:143811286-143811308 GTTCCGGTCCACGTTGAGGTTGG 0: 1
1: 0
2: 1
3: 6
4: 34
1049658962_1049658972 30 Left 1049658962 8:143811257-143811279 CCGATCTCGGGCGGCAGCGCCTC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1049658972 8:143811310-143811332 CAGCTTAGTCAGCTTTCCCAGGG 0: 1
1: 0
2: 0
3: 19
4: 210
1049658962_1049658965 -10 Left 1049658962 8:143811257-143811279 CCGATCTCGGGCGGCAGCGCCTC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1049658965 8:143811270-143811292 GCAGCGCCTCGAGGTGGTTCCGG 0: 1
1: 0
2: 0
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049658962 Original CRISPR GAGGCGCTGCCGCCCGAGAT CGG (reversed) Exonic