ID: 1049658963

View in Genome Browser
Species Human (GRCh38)
Location 8:143811261-143811283
Sequence TCTCGGGCGGCAGCGCCTCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049658951_1049658963 28 Left 1049658951 8:143811210-143811232 CCAGGCGGTTGTCCCTCAAGGAG 0: 1
1: 0
2: 1
3: 4
4: 65
Right 1049658963 8:143811261-143811283 TCTCGGGCGGCAGCGCCTCGAGG 0: 1
1: 0
2: 1
3: 11
4: 86
1049658954_1049658963 15 Left 1049658954 8:143811223-143811245 CCTCAAGGAGAGGACGCTGAGTG 0: 1
1: 0
2: 1
3: 14
4: 178
Right 1049658963 8:143811261-143811283 TCTCGGGCGGCAGCGCCTCGAGG 0: 1
1: 0
2: 1
3: 11
4: 86
1049658957_1049658963 -8 Left 1049658957 8:143811246-143811268 CCACACAGCCCCCGATCTCGGGC 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1049658963 8:143811261-143811283 TCTCGGGCGGCAGCGCCTCGAGG 0: 1
1: 0
2: 1
3: 11
4: 86
1049658953_1049658963 16 Left 1049658953 8:143811222-143811244 CCCTCAAGGAGAGGACGCTGAGT 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1049658963 8:143811261-143811283 TCTCGGGCGGCAGCGCCTCGAGG 0: 1
1: 0
2: 1
3: 11
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049658963 Original CRISPR TCTCGGGCGGCAGCGCCTCG AGG Exonic