ID: 1049658964

View in Genome Browser
Species Human (GRCh38)
Location 8:143811264-143811286
Sequence CGGGCGGCAGCGCCTCGAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049658954_1049658964 18 Left 1049658954 8:143811223-143811245 CCTCAAGGAGAGGACGCTGAGTG 0: 1
1: 0
2: 1
3: 14
4: 178
Right 1049658964 8:143811264-143811286 CGGGCGGCAGCGCCTCGAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 117
1049658953_1049658964 19 Left 1049658953 8:143811222-143811244 CCCTCAAGGAGAGGACGCTGAGT 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1049658964 8:143811264-143811286 CGGGCGGCAGCGCCTCGAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 117
1049658957_1049658964 -5 Left 1049658957 8:143811246-143811268 CCACACAGCCCCCGATCTCGGGC 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1049658964 8:143811264-143811286 CGGGCGGCAGCGCCTCGAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049658964 Original CRISPR CGGGCGGCAGCGCCTCGAGG TGG Exonic