ID: 1049658964 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:143811264-143811286 |
Sequence | CGGGCGGCAGCGCCTCGAGG TGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 128 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 10, 4: 117} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1049658954_1049658964 | 18 | Left | 1049658954 | 8:143811223-143811245 | CCTCAAGGAGAGGACGCTGAGTG | 0: 1 1: 0 2: 1 3: 14 4: 178 |
||
Right | 1049658964 | 8:143811264-143811286 | CGGGCGGCAGCGCCTCGAGGTGG | 0: 1 1: 0 2: 0 3: 10 4: 117 |
||||
1049658953_1049658964 | 19 | Left | 1049658953 | 8:143811222-143811244 | CCCTCAAGGAGAGGACGCTGAGT | 0: 1 1: 0 2: 1 3: 13 4: 138 |
||
Right | 1049658964 | 8:143811264-143811286 | CGGGCGGCAGCGCCTCGAGGTGG | 0: 1 1: 0 2: 0 3: 10 4: 117 |
||||
1049658957_1049658964 | -5 | Left | 1049658957 | 8:143811246-143811268 | CCACACAGCCCCCGATCTCGGGC | 0: 1 1: 0 2: 0 3: 8 4: 138 |
||
Right | 1049658964 | 8:143811264-143811286 | CGGGCGGCAGCGCCTCGAGGTGG | 0: 1 1: 0 2: 0 3: 10 4: 117 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1049658964 | Original CRISPR | CGGGCGGCAGCGCCTCGAGG TGG | Exonic | ||