ID: 1049658965

View in Genome Browser
Species Human (GRCh38)
Location 8:143811270-143811292
Sequence GCAGCGCCTCGAGGTGGTTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049658962_1049658965 -10 Left 1049658962 8:143811257-143811279 CCGATCTCGGGCGGCAGCGCCTC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1049658965 8:143811270-143811292 GCAGCGCCTCGAGGTGGTTCCGG 0: 1
1: 0
2: 0
3: 9
4: 111
1049658960_1049658965 -8 Left 1049658960 8:143811255-143811277 CCCCGATCTCGGGCGGCAGCGCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1049658965 8:143811270-143811292 GCAGCGCCTCGAGGTGGTTCCGG 0: 1
1: 0
2: 0
3: 9
4: 111
1049658954_1049658965 24 Left 1049658954 8:143811223-143811245 CCTCAAGGAGAGGACGCTGAGTG 0: 1
1: 0
2: 1
3: 14
4: 178
Right 1049658965 8:143811270-143811292 GCAGCGCCTCGAGGTGGTTCCGG 0: 1
1: 0
2: 0
3: 9
4: 111
1049658961_1049658965 -9 Left 1049658961 8:143811256-143811278 CCCGATCTCGGGCGGCAGCGCCT 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1049658965 8:143811270-143811292 GCAGCGCCTCGAGGTGGTTCCGG 0: 1
1: 0
2: 0
3: 9
4: 111
1049658957_1049658965 1 Left 1049658957 8:143811246-143811268 CCACACAGCCCCCGATCTCGGGC 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1049658965 8:143811270-143811292 GCAGCGCCTCGAGGTGGTTCCGG 0: 1
1: 0
2: 0
3: 9
4: 111
1049658959_1049658965 -7 Left 1049658959 8:143811254-143811276 CCCCCGATCTCGGGCGGCAGCGC 0: 1
1: 0
2: 0
3: 5
4: 38
Right 1049658965 8:143811270-143811292 GCAGCGCCTCGAGGTGGTTCCGG 0: 1
1: 0
2: 0
3: 9
4: 111
1049658953_1049658965 25 Left 1049658953 8:143811222-143811244 CCCTCAAGGAGAGGACGCTGAGT 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1049658965 8:143811270-143811292 GCAGCGCCTCGAGGTGGTTCCGG 0: 1
1: 0
2: 0
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049658965 Original CRISPR GCAGCGCCTCGAGGTGGTTC CGG Exonic