ID: 1049658967

View in Genome Browser
Species Human (GRCh38)
Location 8:143811282-143811304
Sequence GGTGGTTCCGGTCCACGTTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049658962_1049658967 2 Left 1049658962 8:143811257-143811279 CCGATCTCGGGCGGCAGCGCCTC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1049658967 8:143811282-143811304 GGTGGTTCCGGTCCACGTTGAGG 0: 1
1: 0
2: 0
3: 2
4: 40
1049658957_1049658967 13 Left 1049658957 8:143811246-143811268 CCACACAGCCCCCGATCTCGGGC 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1049658967 8:143811282-143811304 GGTGGTTCCGGTCCACGTTGAGG 0: 1
1: 0
2: 0
3: 2
4: 40
1049658961_1049658967 3 Left 1049658961 8:143811256-143811278 CCCGATCTCGGGCGGCAGCGCCT 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1049658967 8:143811282-143811304 GGTGGTTCCGGTCCACGTTGAGG 0: 1
1: 0
2: 0
3: 2
4: 40
1049658960_1049658967 4 Left 1049658960 8:143811255-143811277 CCCCGATCTCGGGCGGCAGCGCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1049658967 8:143811282-143811304 GGTGGTTCCGGTCCACGTTGAGG 0: 1
1: 0
2: 0
3: 2
4: 40
1049658959_1049658967 5 Left 1049658959 8:143811254-143811276 CCCCCGATCTCGGGCGGCAGCGC 0: 1
1: 0
2: 0
3: 5
4: 38
Right 1049658967 8:143811282-143811304 GGTGGTTCCGGTCCACGTTGAGG 0: 1
1: 0
2: 0
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049658967 Original CRISPR GGTGGTTCCGGTCCACGTTG AGG Exonic
908806362 1:67937119-67937141 GATGGTGCCTGTCCACATTGAGG + Intergenic
922546231 1:226459308-226459330 GATGGTGCCCATCCACGTTGAGG - Intergenic
1101241593 12:102844614-102844636 GGTGGTTCCCGCCCACAATGAGG - Intronic
1110864933 13:80382942-80382964 GGTGGTTCCTATCCTGGTTGTGG + Intergenic
1111795745 13:92917248-92917270 GGTGGATCCTGTCCATGGTGGGG - Intergenic
1114674729 14:24432339-24432361 GGGGGTTCCGGTGCAGGTGGAGG - Exonic
1117864881 14:60136751-60136773 GGTGGTTCTGGCCCTTGTTGTGG + Exonic
1119700762 14:76753017-76753039 GGTGGATCCTCTCCCCGTTGAGG - Intergenic
1122933901 14:104947164-104947186 GGCCTTTCAGGTCCACGTTGGGG + Exonic
1141840139 16:86568616-86568638 GGTGGTTCAGGTCCCCGCTGTGG - Exonic
1142810497 17:2393582-2393604 CGTGGTCCCCGTCCACGCTGCGG - Intronic
1143683196 17:8492826-8492848 GGTGGTCCAGGTCCACCGTGAGG + Exonic
1147701694 17:42400186-42400208 GGTGGTGCCTGCCCACATTGAGG - Intergenic
1158168832 18:54573650-54573672 GGTGGTTCCTTTCCATGTTTAGG + Intergenic
1162341653 19:10094890-10094912 TGTGGTTCCGGTCCGTCTTGTGG - Exonic
927374550 2:22398517-22398539 GGTGGTTGCATTCCAGGTTGAGG + Intergenic
1173709112 20:45139010-45139032 GATGGTTCCGGGTCAAGTTGAGG - Intergenic
1173718157 20:45229682-45229704 GGTGCTTCCGGGTCAAGTTGAGG + Intergenic
1175419564 20:58822844-58822866 GGTGGTTCAGGGCCCTGTTGTGG - Intergenic
1177816645 21:25985387-25985409 GGTGATTCCTGCCCATGTTGAGG - Intronic
966818835 3:183909379-183909401 GGTGGGCCCGATCCCCGTTGCGG - Intergenic
976324235 4:83752616-83752638 GATGGTGCCGGTGCACATTGAGG - Intergenic
979237178 4:118414353-118414375 GATGGTGCCTGTCCACATTGAGG + Intergenic
992103111 5:73426394-73426416 GGTGGTGCCTGTCCACATAGAGG - Intergenic
993068652 5:83132020-83132042 GGTTGTTCCTTTCCACGTTTGGG + Intronic
998285639 5:140857797-140857819 GGTGGTTGCGGGTCACGTGGTGG + Exonic
998286855 5:140870852-140870874 GGTGGGTGCGGGCCACGTGGTGG + Exonic
998287495 5:140877224-140877246 GGTGGGTGCGGGCCACGTGGTGG + Exonic
998514401 5:142739676-142739698 GATGGTTCCTGCCCACATTGGGG - Intergenic
1000186190 5:158860506-158860528 GGTGGCTCCTGTCCACATGGTGG - Intronic
1021900363 7:25279251-25279273 GATGGTGCCTGCCCACGTTGAGG - Intergenic
1022227881 7:28382229-28382251 GATGGTGCCTGCCCACGTTGAGG + Intronic
1026776705 7:73235198-73235220 GGTGGATGCTGTGCACGTTGCGG - Intergenic
1030550189 7:110948837-110948859 GATGATGCCCGTCCACGTTGAGG - Intronic
1033256954 7:139809786-139809808 GGTGGTGCCCGTCCATGTTGAGG + Intronic
1039838133 8:41273865-41273887 GGTGGTGCCAGCCCACATTGAGG - Intronic
1044414213 8:91917707-91917729 GCTGGATCCTGTCCAGGTTGAGG - Intergenic
1048014405 8:130484510-130484532 GGTTGTTCTGGTTCAGGTTGAGG - Intergenic
1049658967 8:143811282-143811304 GGTGGTTCCGGTCCACGTTGAGG + Exonic
1051941933 9:22517341-22517363 GGTGTTTCCAGTACAAGTTGTGG - Intergenic
1186271399 X:7892092-7892114 GGTGGTTCTGGTCCTTGTTCTGG + Intergenic
1189259117 X:39665152-39665174 GATGGTGCCTGTCCATGTTGAGG + Intergenic
1194570318 X:95548024-95548046 GGTTGTTCCTTTCCACGTTTAGG + Intergenic