ID: 1049658968

View in Genome Browser
Species Human (GRCh38)
Location 8:143811286-143811308
Sequence GTTCCGGTCCACGTTGAGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 34}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049658959_1049658968 9 Left 1049658959 8:143811254-143811276 CCCCCGATCTCGGGCGGCAGCGC 0: 1
1: 0
2: 0
3: 5
4: 38
Right 1049658968 8:143811286-143811308 GTTCCGGTCCACGTTGAGGTTGG 0: 1
1: 0
2: 1
3: 6
4: 34
1049658962_1049658968 6 Left 1049658962 8:143811257-143811279 CCGATCTCGGGCGGCAGCGCCTC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1049658968 8:143811286-143811308 GTTCCGGTCCACGTTGAGGTTGG 0: 1
1: 0
2: 1
3: 6
4: 34
1049658960_1049658968 8 Left 1049658960 8:143811255-143811277 CCCCGATCTCGGGCGGCAGCGCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1049658968 8:143811286-143811308 GTTCCGGTCCACGTTGAGGTTGG 0: 1
1: 0
2: 1
3: 6
4: 34
1049658961_1049658968 7 Left 1049658961 8:143811256-143811278 CCCGATCTCGGGCGGCAGCGCCT 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1049658968 8:143811286-143811308 GTTCCGGTCCACGTTGAGGTTGG 0: 1
1: 0
2: 1
3: 6
4: 34
1049658957_1049658968 17 Left 1049658957 8:143811246-143811268 CCACACAGCCCCCGATCTCGGGC 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1049658968 8:143811286-143811308 GTTCCGGTCCACGTTGAGGTTGG 0: 1
1: 0
2: 1
3: 6
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049658968 Original CRISPR GTTCCGGTCCACGTTGAGGT TGG Exonic