ID: 1049658968

View in Genome Browser
Species Human (GRCh38)
Location 8:143811286-143811308
Sequence GTTCCGGTCCACGTTGAGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 34}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049658962_1049658968 6 Left 1049658962 8:143811257-143811279 CCGATCTCGGGCGGCAGCGCCTC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1049658968 8:143811286-143811308 GTTCCGGTCCACGTTGAGGTTGG 0: 1
1: 0
2: 1
3: 6
4: 34
1049658960_1049658968 8 Left 1049658960 8:143811255-143811277 CCCCGATCTCGGGCGGCAGCGCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1049658968 8:143811286-143811308 GTTCCGGTCCACGTTGAGGTTGG 0: 1
1: 0
2: 1
3: 6
4: 34
1049658961_1049658968 7 Left 1049658961 8:143811256-143811278 CCCGATCTCGGGCGGCAGCGCCT 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1049658968 8:143811286-143811308 GTTCCGGTCCACGTTGAGGTTGG 0: 1
1: 0
2: 1
3: 6
4: 34
1049658957_1049658968 17 Left 1049658957 8:143811246-143811268 CCACACAGCCCCCGATCTCGGGC 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1049658968 8:143811286-143811308 GTTCCGGTCCACGTTGAGGTTGG 0: 1
1: 0
2: 1
3: 6
4: 34
1049658959_1049658968 9 Left 1049658959 8:143811254-143811276 CCCCCGATCTCGGGCGGCAGCGC 0: 1
1: 0
2: 0
3: 5
4: 38
Right 1049658968 8:143811286-143811308 GTTCCGGTCCACGTTGAGGTTGG 0: 1
1: 0
2: 1
3: 6
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049658968 Original CRISPR GTTCCGGTCCACGTTGAGGT TGG Exonic
900178595 1:1301746-1301768 GGTCCAGTCCACGTTGGGTTTGG - Intronic
904323854 1:29714397-29714419 GTGCCTGTCCACATTGAGGGCGG - Intergenic
908806363 1:67937123-67937145 GTGCCTGTCCACATTGAGGTTGG + Intergenic
922546230 1:226459304-226459326 GTGCCCATCCACGTTGAGGATGG - Intergenic
1071794630 10:88991195-88991217 ACTGCGCTCCACGTTGAGGTGGG + Exonic
1080789389 11:35508150-35508172 GTTCCTGTGCACTTTGAGGCAGG + Intronic
1084543198 11:69800115-69800137 TTTCCTGTGCACCTTGAGGTGGG + Intergenic
1096575889 12:52552718-52552740 GTCCAGCTCCACGTTGAGGGGGG + Exonic
1096579159 12:52573388-52573410 GTCCAGCTCCACGTTGAGGGGGG + Exonic
1107456246 13:40557686-40557708 GTTTCAGTCCAGGTGGAGGTTGG - Exonic
1112247573 13:97748503-97748525 CTTACGGTCCACCTTGAGGAGGG + Intergenic
1113190941 13:107745081-107745103 ATTCCAGTCCACGGTGAGGAAGG + Intronic
1114613769 14:24057843-24057865 GTTGCGAGCCAGGTTGAGGTAGG - Exonic
1116127938 14:40813241-40813263 GTTCCCACCCACGTTGAGGGTGG + Intergenic
1116127951 14:40813311-40813333 GTTCCCACCCACGTTGAGGGTGG + Intergenic
1118723387 14:68609579-68609601 CTTCCGGTCCAGGCTGAGGACGG - Intronic
1119304226 14:73594399-73594421 GTTCAGGGCCACATTCAGGTAGG - Intronic
1120942444 14:89961638-89961660 GTTCCGGGCCATGATGAGATGGG - Intronic
1148836440 17:50468199-50468221 GTTCCTGTCCACGTGGAATTTGG + Exonic
1148836483 17:50468415-50468437 GTTGTGGTCCAGGTAGAGGTAGG + Exonic
1166154941 19:40903869-40903891 GTTCCGCTCCACACTGAGGTGGG + Intergenic
1166173131 19:41046463-41046485 GTTCCGCTCCATGCTGAGGTGGG - Intergenic
1168689395 19:58367764-58367786 CTTCCGGTGCTCGTTGAGGTTGG + Exonic
926563535 2:14444518-14444540 GTGCCCATCCAGGTTGAGGTGGG - Intergenic
932461306 2:71883653-71883675 GTTCCTGCACACGTGGAGGTGGG + Intergenic
936646701 2:114380183-114380205 GTGCCTGTCCACGTTAATGTTGG + Intergenic
938063597 2:128269698-128269720 GCTCCTGTCCACGCTGGGGTGGG + Intronic
1170450053 20:16473599-16473621 GTTAGGGTCCAAGTTGAGGTGGG - Intronic
1173421744 20:42907398-42907420 ATTCCAGTCAACGTTGAGGTTGG - Intronic
1181079832 22:20406487-20406509 GCGCCGGTGCACGATGAGGTAGG - Exonic
951564225 3:23997001-23997023 CTTCTGGTCCAGGTTGAGTTTGG + Intergenic
957651651 3:83014126-83014148 GTGCCTGTCCACACTGAGGTTGG - Intergenic
997441126 5:133909245-133909267 GTTCTGGCCCACCTTGAGATGGG + Intergenic
1012157172 6:95833931-95833953 ATTCCAGTGCACATTGAGGTTGG - Intergenic
1029219466 7:98976653-98976675 GTTCCGGTCCACGCTGATGTTGG + Exonic
1030550187 7:110948833-110948855 ATGCCCGTCCACGTTGAGGGTGG - Intronic
1032023123 7:128421200-128421222 GTTCTGGTCCATGTTCAGGAGGG + Intergenic
1032425301 7:131817992-131818014 GTTACTGTCCTTGTTGAGGTTGG - Intergenic
1041830003 8:62143447-62143469 GTTCCGGTTCTCGTCGATGTAGG + Intergenic
1049658968 8:143811286-143811308 GTTCCGGTCCACGTTGAGGTTGG + Exonic
1060876690 9:127089062-127089084 GTACCAGACCCCGTTGAGGTTGG + Exonic
1199808270 X:151323961-151323983 GTTCCAGTCCACTCTGAGGGAGG - Intergenic