ID: 1049658971

View in Genome Browser
Species Human (GRCh38)
Location 8:143811309-143811331
Sequence TCAGCTTAGTCAGCTTTCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 145}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049658970_1049658971 -8 Left 1049658970 8:143811294-143811316 CCACGTTGAGGTTGGTCAGCTTA 0: 1
1: 0
2: 0
3: 4
4: 34
Right 1049658971 8:143811309-143811331 TCAGCTTAGTCAGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 145
1049658961_1049658971 30 Left 1049658961 8:143811256-143811278 CCCGATCTCGGGCGGCAGCGCCT 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1049658971 8:143811309-143811331 TCAGCTTAGTCAGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 145
1049658962_1049658971 29 Left 1049658962 8:143811257-143811279 CCGATCTCGGGCGGCAGCGCCTC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1049658971 8:143811309-143811331 TCAGCTTAGTCAGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 145
1049658966_1049658971 10 Left 1049658966 8:143811276-143811298 CCTCGAGGTGGTTCCGGTCCACG 0: 1
1: 0
2: 0
3: 0
4: 39
Right 1049658971 8:143811309-143811331 TCAGCTTAGTCAGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 145
1049658969_1049658971 -3 Left 1049658969 8:143811289-143811311 CCGGTCCACGTTGAGGTTGGTCA 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1049658971 8:143811309-143811331 TCAGCTTAGTCAGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049658971 Original CRISPR TCAGCTTAGTCAGCTTTCCC AGG Exonic