ID: 1049658972

View in Genome Browser
Species Human (GRCh38)
Location 8:143811310-143811332
Sequence CAGCTTAGTCAGCTTTCCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 210}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049658966_1049658972 11 Left 1049658966 8:143811276-143811298 CCTCGAGGTGGTTCCGGTCCACG 0: 1
1: 0
2: 0
3: 0
4: 39
Right 1049658972 8:143811310-143811332 CAGCTTAGTCAGCTTTCCCAGGG 0: 1
1: 0
2: 0
3: 19
4: 210
1049658969_1049658972 -2 Left 1049658969 8:143811289-143811311 CCGGTCCACGTTGAGGTTGGTCA 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1049658972 8:143811310-143811332 CAGCTTAGTCAGCTTTCCCAGGG 0: 1
1: 0
2: 0
3: 19
4: 210
1049658970_1049658972 -7 Left 1049658970 8:143811294-143811316 CCACGTTGAGGTTGGTCAGCTTA 0: 1
1: 0
2: 0
3: 4
4: 34
Right 1049658972 8:143811310-143811332 CAGCTTAGTCAGCTTTCCCAGGG 0: 1
1: 0
2: 0
3: 19
4: 210
1049658962_1049658972 30 Left 1049658962 8:143811257-143811279 CCGATCTCGGGCGGCAGCGCCTC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1049658972 8:143811310-143811332 CAGCTTAGTCAGCTTTCCCAGGG 0: 1
1: 0
2: 0
3: 19
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049658972 Original CRISPR CAGCTTAGTCAGCTTTCCCA GGG Exonic