ID: 1049660486

View in Genome Browser
Species Human (GRCh38)
Location 8:143817635-143817657
Sequence GCGGCAGGTGGGAGGCCTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 314}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049660475_1049660486 27 Left 1049660475 8:143817585-143817607 CCCTCACCTGAGCTGTGATCTTG 0: 1
1: 0
2: 1
3: 32
4: 327
Right 1049660486 8:143817635-143817657 GCGGCAGGTGGGAGGCCTCCAGG 0: 1
1: 0
2: 3
3: 22
4: 314
1049660478_1049660486 21 Left 1049660478 8:143817591-143817613 CCTGAGCTGTGATCTTGGCAGTG 0: 1
1: 0
2: 3
3: 13
4: 256
Right 1049660486 8:143817635-143817657 GCGGCAGGTGGGAGGCCTCCAGG 0: 1
1: 0
2: 3
3: 22
4: 314
1049660476_1049660486 26 Left 1049660476 8:143817586-143817608 CCTCACCTGAGCTGTGATCTTGG 0: 1
1: 0
2: 3
3: 22
4: 239
Right 1049660486 8:143817635-143817657 GCGGCAGGTGGGAGGCCTCCAGG 0: 1
1: 0
2: 3
3: 22
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049660486 Original CRISPR GCGGCAGGTGGGAGGCCTCC AGG Exonic
900204975 1:1427809-1427831 GCGCGAGCTCGGAGGCCTCCCGG - Intergenic
900245225 1:1633376-1633398 GCTGCAGAGGAGAGGCCTCCAGG - Intronic
900256456 1:1700535-1700557 GCTGCAGAGGAGAGGCCTCCAGG - Intronic
900339175 1:2179745-2179767 GCTGCTGGTGGGAGGCCCCAGGG + Intronic
900376459 1:2357053-2357075 GCGGCTGCTGTGAGGGCTCCCGG + Intronic
900547922 1:3238794-3238816 CCGGCAGGACAGAGGCCTCCGGG - Intronic
900740796 1:4329579-4329601 GAGGAAGCTGGGAGGCCTCCAGG - Intergenic
900887127 1:5423082-5423104 GTGGCAGGTGGGAGACAGCCTGG - Intergenic
901152395 1:7112610-7112632 GCGGGAGGGAGGAGGCCTCAAGG - Intronic
901439164 1:9267182-9267204 GCGCCAGGAGGGCGGCTTCCTGG - Exonic
902247266 1:15129147-15129169 GTGGCAGGCAGGTGGCCTCCTGG + Intergenic
902780326 1:18700731-18700753 CCGGTGGGTGGGAAGCCTCCTGG - Exonic
902810062 1:18883076-18883098 GCGGCAGCTGGTTGTCCTCCTGG - Intronic
902841015 1:19073870-19073892 GGAGCAGGTCTGAGGCCTCCAGG + Intergenic
903060328 1:20664491-20664513 GTGGCAGGTGGGAGGAGACCTGG + Exonic
903420817 1:23217106-23217128 CCGGCCGGAGGGAGGCCACCGGG - Intergenic
903684108 1:25118766-25118788 GATGCTCGTGGGAGGCCTCCTGG + Intergenic
904035303 1:27555761-27555783 GCCCCAGCTGGGAGGTCTCCAGG - Intronic
904307813 1:29601563-29601585 ACTCCAGGTGGAAGGCCTCCTGG + Intergenic
905033799 1:34904542-34904564 CTGGCGGGTGGGAGGCCCCCTGG - Exonic
905308488 1:37034407-37034429 GGGGCAGGTGGGAGCCCGCGCGG - Intergenic
907425051 1:54374273-54374295 GCTGCAGGCTGCAGGCCTCCTGG - Intronic
907594116 1:55703948-55703970 GCACCAGCTGGGAGCCCTCCTGG - Intergenic
909196798 1:72636900-72636922 GAGGCAGCTGAGTGGCCTCCAGG - Intergenic
910694302 1:89995381-89995403 GGGGCGGGCGGGCGGCCTCCGGG - Intronic
910937099 1:92493359-92493381 GCTGCAGGAGGTAGGCCTCAAGG + Intergenic
913709984 1:121473145-121473167 GTGGCAGGTAGGAGCCCTCATGG - Intergenic
914376397 1:147077344-147077366 GGGGCAGGTGGGAGGCGCGCGGG - Intergenic
915736842 1:158090511-158090533 GCAGCAGGCGGCTGGCCTCCCGG + Intronic
915915845 1:159940435-159940457 GCAGGTGGAGGGAGGCCTCCAGG - Intronic
917498448 1:175564231-175564253 GCAGCAGGAGGGAGGCCCCAGGG - Intronic
919467320 1:197938059-197938081 GCAGCAGGTGCGTGGCCTGCGGG - Intergenic
922566658 1:226605721-226605743 GGGGCAGGGTGGAGGCGTCCAGG - Exonic
922657840 1:227401622-227401644 GAAGCAGGTGAGAAGCCTCCTGG + Intergenic
922773749 1:228205635-228205657 GGTGCAGGTCTGAGGCCTCCGGG + Intronic
923612256 1:235505252-235505274 GCCCCGGGTGGGAGCCCTCCTGG + Intergenic
1062820987 10:534356-534378 GCGGCAGGAGGGAAGCAGCCTGG + Intronic
1063185449 10:3646437-3646459 GGGGCAGGTGGGAAGGTTCCAGG + Intergenic
1063294214 10:4786520-4786542 AAGGCAGGTGGGAGGCATCACGG + Intergenic
1065589817 10:27252708-27252730 GGGGCAGGTGGGCCGCCGCCAGG - Intergenic
1065843733 10:29727805-29727827 GTGCCAGGTGGGAGGGCTCTGGG + Intronic
1066032039 10:31438136-31438158 ACGCCAGGAGGGAGGCCTCGTGG - Intronic
1067045303 10:42981988-42982010 GGAGCAGGTGGGAAGGCTCCAGG - Intergenic
1067279743 10:44862216-44862238 ACTGCAGGTGGCTGGCCTCCAGG + Intergenic
1070328233 10:75401441-75401463 GCAGCGGGGGGGAGGGCTCCGGG + Exonic
1070657834 10:78283377-78283399 GCTGCAGGTGGGAGGCCTGCAGG + Intergenic
1070696000 10:78563546-78563568 GAGGGAGGTGGGAGGCCCACTGG - Intergenic
1070803166 10:79255241-79255263 GCGGCAGGTAGGTGGCCTCAGGG + Intronic
1072921015 10:99577347-99577369 GTGGCATGTGGGAAGCCTCAAGG - Intergenic
1074957674 10:118408326-118408348 GCTGCAGATGCGAGGCCTGCTGG - Intergenic
1076064741 10:127440296-127440318 GCGGCCAGTGGGAGGCATCTGGG - Intronic
1076093769 10:127713658-127713680 GGAGCAGGTGGGCGGCCTTCAGG - Intergenic
1076369336 10:129941568-129941590 GGGTCAGGGGGGAGCCCTCCAGG + Intronic
1076789138 10:132767612-132767634 GCGGGATGGGGGAGCCCTCCAGG - Intronic
1076806827 10:132862937-132862959 ACGGGAGGTAGGAGGCCTTCAGG + Intronic
1077085592 11:748266-748288 GCGGCAGGTGCCCGGCCTGCTGG + Intronic
1077373585 11:2195006-2195028 GTGGCAGGTGGCAGGCATGCTGG + Intergenic
1080908918 11:36575449-36575471 GCGGGAAGTGGAAGGCCTCGAGG + Exonic
1082009004 11:47438005-47438027 GCGGCAGTTGGGACAGCTCCGGG + Exonic
1082095438 11:48125972-48125994 GTGGCAGGTGGGAGGCTCTCGGG + Intronic
1083615211 11:64022743-64022765 GTGGAAGGTGGGAGACTTCCTGG + Intronic
1083668313 11:64286909-64286931 GCGGGAGGTGGCAAGCCTCAAGG + Intronic
1084274142 11:68043223-68043245 GGGGAAGGCAGGAGGCCTCCCGG - Intronic
1084275683 11:68049901-68049923 GCGGGTGGTGGGGGACCTCCTGG + Intronic
1084399701 11:68936514-68936536 GCGGCAGGAGGGAGGCCAGGAGG + Exonic
1085458035 11:76676491-76676513 GGGGCAGGTGGAAGCCCTCAAGG + Intergenic
1087083703 11:94196356-94196378 GGGGCAGGCGGGAAGTCTCCTGG + Intergenic
1088746461 11:112808546-112808568 GCCTCAGCTGGGTGGCCTCCTGG - Intergenic
1088833375 11:113557024-113557046 CTGGCAGATGGGAGGCATCCTGG + Intergenic
1089122103 11:116144748-116144770 TCTGCAGGTTGGAGGCCTGCTGG - Intergenic
1090226116 11:125073203-125073225 GGAGCAGGTGGGAGGGCCCCGGG + Intronic
1090534682 11:127627467-127627489 GCAGCAGGTGAGGGGCCTCAAGG + Intergenic
1092174010 12:6390752-6390774 GGGGTAGCTGGGAGGTCTCCAGG - Exonic
1092279114 12:7086331-7086353 GCAGGAGGTGGGAGGTCCCCAGG + Intronic
1092291184 12:7160267-7160289 GAGGCAGGTGGGAGGCAGGCGGG - Intergenic
1095942386 12:47735576-47735598 GGGGCAGCTGGGAGACCACCGGG + Intronic
1096686368 12:53290924-53290946 CCTGTAGGCGGGAGGCCTCCTGG - Exonic
1101746385 12:107544656-107544678 GAGGCAGACAGGAGGCCTCCAGG - Intronic
1102237648 12:111304227-111304249 GCGGGAGGTGGAAAGTCTCCGGG + Exonic
1103095969 12:118132662-118132684 GCGGGAGGTGGGAGGACCGCTGG + Intronic
1103714663 12:122937634-122937656 GTGCCAAGTGGGAGGCCACCAGG - Intronic
1104724327 12:131066699-131066721 GCAGCACGTGGGAGGCCTGCTGG + Intronic
1104896999 12:132169331-132169353 GTGGCAGGGGGGAGACCTCAGGG + Intergenic
1104961432 12:132490208-132490230 GCGGCAGGCGGGAGGCGGCCGGG - Exonic
1104978021 12:132560772-132560794 GGTACAGGTGGGAGGACTCCGGG - Intronic
1107884693 13:44865721-44865743 GGGGCAGGTGAGAGGCAACCTGG - Intergenic
1108382547 13:49868181-49868203 GGGGAGGGTGGGAGGCCACCAGG - Intergenic
1108416299 13:50201240-50201262 TGGGCAGGGAGGAGGCCTCCTGG + Intronic
1112065923 13:95793018-95793040 GCAGCAGGTGGGAGGTGGCCAGG - Exonic
1113231095 13:108215200-108215222 GCGGCAGGTGGGGGGTGTTCGGG - Intronic
1118883817 14:69850435-69850457 GCGGCAGGGGAGGGGCCGCCTGG - Intergenic
1121693318 14:95893206-95893228 GGGAGAGGTGGGAGGCCACCTGG + Intergenic
1122246310 14:100405676-100405698 TCGGGAGGTGGGTGGCCTGCAGG + Intronic
1122623027 14:103070536-103070558 GCGGGAGGTGGGGGGCCATCTGG + Intergenic
1122798705 14:104219132-104219154 GAGGCAGGTCAGAGGCTTCCAGG - Intergenic
1202848774 14_GL000225v1_random:2368-2390 GTGGCAGCTGGGAGGCTTCAGGG - Intergenic
1126348028 15:47717281-47717303 GCGCCAGGGTGGGGGCCTCCAGG + Intronic
1128456647 15:67835035-67835057 GCGGCAGGGCGGAGGTCTCAGGG + Intergenic
1128788505 15:70415576-70415598 GCAGCAGGTGGGAGCCCCACCGG + Intergenic
1129870324 15:78936093-78936115 GCAGCAGGTGGGAAGGCCCCTGG - Intronic
1130202204 15:81842530-81842552 GCAGCAAGTGGGAGAGCTCCAGG - Intergenic
1131270185 15:90942511-90942533 GCAGCAGGTGGCAGGCAGCCAGG - Exonic
1131870273 15:96756847-96756869 ACGCCAGGTTGGGGGCCTCCGGG - Intergenic
1132579288 16:677746-677768 GCGGCAGGTGGGAGGTGCCCTGG - Intronic
1132658326 16:1050524-1050546 GGGGCAGGTGGGATGCCTGTGGG + Intergenic
1133232972 16:4374982-4375004 GCGGCAGGTGTGATGCCACCAGG - Intronic
1133737843 16:8629418-8629440 GCAGCAGCAGGGAGGCTTCCTGG - Intronic
1136030037 16:27496020-27496042 GGGCCAGGTGGGAGGCGTCTGGG + Intronic
1137028832 16:35503280-35503302 GTGGCAGTTGTGAGGCCACCAGG - Intergenic
1138389926 16:56662884-56662906 GGGGCAGGTGGGAGGCATGGTGG + Intronic
1138391873 16:56676117-56676139 GGGGCAGGTGGGAGGCGTGGTGG - Exonic
1139671105 16:68492945-68492967 GAGGCAGGTGGCAGCCATCCCGG - Intergenic
1142045906 16:87925138-87925160 GAGGCAGATGGGATGCCTGCCGG + Intronic
1142339055 16:89508666-89508688 GGGGCGGGTCGGAGGCCGCCTGG + Intronic
1143646607 17:8234526-8234548 TGGGCAGGTAGGAGGCCTCCGGG + Exonic
1144652977 17:17018718-17018740 GCGGGAGGTCTGAGGGCTCCTGG - Intergenic
1145057809 17:19714705-19714727 GTCTCAGGTGGGTGGCCTCCTGG - Exonic
1145261784 17:21358846-21358868 GGGGCAGCAGGGAGGCCTGCAGG + Intergenic
1146339636 17:32007742-32007764 GGGGCAGGTGGGCAGCCGCCAGG + Intergenic
1146372046 17:32270711-32270733 GCAGCAGGTGGGAGACCTGAGGG + Intronic
1147166446 17:38596096-38596118 GCGGCGGGAGGGAAGCCTCCAGG - Intronic
1147384671 17:40074264-40074286 GTGGCAGGTGGGAGGGCTGGGGG - Exonic
1147567410 17:41546247-41546269 GGGGCTGGCGGGGGGCCTCCTGG - Intergenic
1148863710 17:50617934-50617956 CCGGGAGGTGGGGGGCCTCTGGG + Intronic
1150607590 17:66707448-66707470 GAGGCTGGTTGGAGGCCTTCAGG + Intronic
1152157754 17:78646062-78646084 GCGGCAGGCGGGACTCATCCGGG + Intergenic
1152312113 17:79557770-79557792 GCATCTCGTGGGAGGCCTCCTGG + Intergenic
1152516628 17:80828588-80828610 CAGGCAGGTGGGTGGCCACCGGG - Intronic
1152572765 17:81127776-81127798 CCTACAGGTGGGAGGCCACCGGG - Exonic
1152798472 17:82320305-82320327 GCTCCAGGCGGGAGGGCTCCTGG - Intergenic
1152930985 17:83109760-83109782 GTGGCCAGTGGGAGGCCTGCTGG - Intergenic
1152963511 18:95524-95546 GCAGCAGGTGGGAGCGCTCAGGG + Intergenic
1155225878 18:23728547-23728569 GCAGCAGGAGGGAAGCCTTCTGG - Intronic
1156449637 18:37259628-37259650 AGGGCAGGAGGGAGGCCTCCCGG - Intronic
1156769871 18:40707233-40707255 GCAGCAAGTGGGAAGCTTCCAGG + Intergenic
1157590403 18:48833276-48833298 GCTGCAGGCGGGAGGCCTCGTGG + Intronic
1160442219 18:78901623-78901645 CCAGCAGGTGGGAGGCTGCCTGG + Intergenic
1160745525 19:709333-709355 CCGGGAGCGGGGAGGCCTCCCGG - Intronic
1160792162 19:927877-927899 GGGGCAGGTGGGTGGCCCCTGGG - Intronic
1160975845 19:1792027-1792049 GCAGCAGGAGGCTGGCCTCCTGG + Exonic
1161068109 19:2248193-2248215 GGGGCTGGTGGGTGGACTCCGGG - Exonic
1161136441 19:2622673-2622695 GCGGCAGATAGGGGGCTTCCGGG + Intronic
1161153438 19:2721053-2721075 TCGGCAGGGGGGCGCCCTCCGGG + Intronic
1161418884 19:4164514-4164536 GCAGGAGGTAGGAGGCCCCCAGG - Exonic
1162113433 19:8413572-8413594 AAGGCCGGTGGGAGGTCTCCGGG + Intronic
1162131298 19:8527582-8527604 GAGGAAGGTGGGAGCCCTCCAGG + Intronic
1162923721 19:13919084-13919106 GCTGCCTGTGGGAGGGCTCCCGG - Intronic
1163291951 19:16384763-16384785 CCTGCAGGTGCGAGGCGTCCAGG - Intronic
1164752558 19:30667454-30667476 TCGGCATGGGGGAGGCCTCCCGG - Intronic
1164809892 19:31147505-31147527 GTGGCAGGTTGGACTCCTCCAGG + Intergenic
1165071887 19:33260667-33260689 GGGCCGGGTGGGAGGCCTCGTGG - Intergenic
1166051972 19:40265845-40265867 GTGGCAGGTTGGTGGCTTCCTGG - Intronic
1166254448 19:41592348-41592370 GCCTCAGGTGGGCGGCCACCTGG - Intronic
1166385103 19:42376386-42376408 GCGGGAGGTGGGAGCCCAGCCGG - Exonic
1167212006 19:48139328-48139350 GAGGCAGGAGGAATGCCTCCAGG - Intronic
1167593578 19:50416644-50416666 GGGCAAGGTGGGCGGCCTCCTGG + Exonic
1167661546 19:50798604-50798626 GTGCCAGCTGGGAGTCCTCCCGG - Exonic
1168275175 19:55274035-55274057 GCATCTGGTGGGTGGCCTCCAGG - Intronic
1168290244 19:55354078-55354100 GGGGCGGGACGGAGGCCTCCAGG - Exonic
925047617 2:785985-786007 GCGGGAGGTGGGAGAGCTACAGG + Intergenic
925174595 2:1773337-1773359 GCGCCAGCAGGGCGGCCTCCAGG + Intergenic
928620632 2:33084396-33084418 GCTGCTGGTGGGAGGCGTCCTGG + Intronic
929437744 2:41940995-41941017 GAGGCCGGAAGGAGGCCTCCGGG + Intronic
929771270 2:44894198-44894220 GCGGCAGGAGGGAGGGCTCTGGG - Intergenic
929887776 2:45893880-45893902 GCAGCATATAGGAGGCCTCCTGG + Intronic
930071596 2:47370048-47370070 GCGCCCGCAGGGAGGCCTCCAGG + Intronic
931133814 2:59373861-59373883 GCATCAGGTGGGAGGACTTCTGG + Intergenic
932163782 2:69487271-69487293 GATGCAGATGGAAGGCCTCCAGG - Intronic
932780016 2:74554022-74554044 GCGGAATGTGGGAGGGCTCAGGG - Intronic
933858598 2:86441963-86441985 GCGGCCGGTGGGAGGGGGCCGGG - Intronic
936462198 2:112722115-112722137 AGGACAGGTGGGAGGCCACCCGG + Intronic
936938552 2:117860121-117860143 GCGGCAGGTGGAAGGCGCCGCGG - Intergenic
937183026 2:120013064-120013086 GCGGGAGGTCGGGGTCCTCCGGG + Exonic
937375810 2:121334967-121334989 GCTGCAGGTGCCTGGCCTCCAGG - Intergenic
937466646 2:122138772-122138794 CTGGCAGGTGGGAGGGGTCCTGG - Intergenic
937984841 2:127633754-127633776 GGGGCAGGTAGGAGACCACCAGG + Intronic
940709453 2:157144329-157144351 GAGCCAGGTGAGAAGCCTCCTGG - Intergenic
941616493 2:167726359-167726381 GGGGCAGGTGGGCGGATTCCTGG - Intergenic
942346109 2:175004846-175004868 GCCGCAGGTGGGCCGCGTCCCGG - Intronic
942748593 2:179264242-179264264 GCCGGAGGTGGGAGCCCTGCGGG - Intronic
944237071 2:197450613-197450635 GCGGCAGGCTGAAGGGCTCCTGG - Intergenic
946433538 2:219638039-219638061 GAGGCACGTGGGGGGCCTTCTGG + Intronic
948503433 2:238411245-238411267 GGGGCAGGTGGGGGGCGTCAAGG + Intergenic
948703630 2:239776323-239776345 GCGGCAGGCGTGGGGCCTCTGGG - Intronic
948765035 2:240215230-240215252 GCAGCAGGTGGAAGGCCTGGTGG + Intergenic
949028096 2:241775641-241775663 ACGGCAGGTGGGAGGGATGCCGG - Intergenic
949048907 2:241886521-241886543 GGGGCAGGTGGCAGACCTCGGGG + Intergenic
1169144094 20:3241115-3241137 GAGGCAGGTGGGAGGACTGAAGG - Intergenic
1169224362 20:3846976-3846998 GCGGCAGGACGGAGTCCGCCGGG + Intronic
1169252525 20:4071533-4071555 GTGGCTGGTGGGTGGGCTCCTGG + Intronic
1169264974 20:4162060-4162082 GCGGCAGGTCGTGTGCCTCCTGG + Intronic
1171077839 20:22147254-22147276 ATGGCAGGTGGGAGGCCTGGGGG - Intergenic
1173026347 20:39310831-39310853 CGGGCTGCTGGGAGGCCTCCTGG + Intergenic
1173548505 20:43916298-43916320 GAGGCAGGAGAGAGGCGTCCCGG + Intronic
1175997699 20:62818847-62818869 GAAGAAGGTGGGAGGGCTCCAGG - Intronic
1176015567 20:62929437-62929459 GAGGCAGGATGGAGGCCTGCAGG + Intronic
1176295259 21:5068767-5068789 GGGGCAGGGGGGAGGCCTCCTGG - Intergenic
1177825437 21:26077628-26077650 GTCGCAGGAGAGAGGCCTCCAGG - Intronic
1179417927 21:41213303-41213325 GCTGCAGCTGGGAGGCCTTCTGG + Intronic
1179861790 21:44193361-44193383 GGGGCAGGGGGGAGGCCTCCTGG + Intergenic
1179923193 21:44518654-44518676 GGGGCAGGGGGCGGGCCTCCAGG - Exonic
1179939602 21:44629025-44629047 ACAGCAGGAAGGAGGCCTCCTGG + Intronic
1180085587 21:45506704-45506726 TTGGAAGGTGGGAGGGCTCCAGG - Intronic
1181882563 22:25992525-25992547 GCAGCAGGTGGGCGGCATCCTGG + Intronic
1182618624 22:31605464-31605486 GGGGCATGTGGGAGGACTGCTGG - Intronic
1183149843 22:36028747-36028769 GCGGCCGGTGGGCGAGCTCCGGG - Intergenic
1183369631 22:37425238-37425260 GCAGCACATTGGAGGCCTCCAGG + Intronic
1183374247 22:37453804-37453826 CCCGCAGGTGGCAGGCCGCCTGG - Intergenic
1183458851 22:37937393-37937415 GCGGCAGCTGAGAGTCCTACGGG - Intronic
1183489722 22:38109905-38109927 GTGGGTGGTGTGAGGCCTCCAGG + Intronic
1183735776 22:39644046-39644068 TGGGGAGGTGGGAGGCTTCCTGG + Intronic
1183744517 22:39685273-39685295 GCTGCAGGTGGGGGGCCCCGGGG + Intronic
1183958241 22:41395485-41395507 GCAGCAGGTACCAGGCCTCCAGG + Intronic
1184107509 22:42376761-42376783 GAGGCAGGAGGGAGGCCATCTGG + Intergenic
1184298866 22:43543324-43543346 GGGGCAGGTGGGAGCCGCCCTGG - Intronic
1184852060 22:47126658-47126680 GCGGTAGGCTGGAGGCCTCAAGG + Intronic
1185137562 22:49081336-49081358 AGGGCAGATGGGATGCCTCCAGG - Intergenic
1185320460 22:50198248-50198270 GCCGCATGTGGTTGGCCTCCAGG - Intronic
949304718 3:2627099-2627121 GCTGAAGTTGGGAGACCTCCTGG + Intronic
950303485 3:11901194-11901216 GCTCCAGGGGGGAGTCCTCCAGG - Intergenic
950506392 3:13397384-13397406 GCTCCAGGGGGGAGTCCTCCAGG + Exonic
950543437 3:13625523-13625545 GGGGAAGGTGGGAGCCCTGCTGG - Intronic
952879309 3:37973427-37973449 GGGGCAGGTGGGAGCCATCCAGG - Intronic
953435898 3:42876907-42876929 TGGGCAGGTGAGAGGGCTCCGGG - Intronic
954278832 3:49561106-49561128 GAGGCACATGGGAAGCCTCCAGG + Intronic
954539664 3:51385195-51385217 GTGGCATGTGGGAGGGCGCCGGG + Exonic
954578449 3:51689915-51689937 GCTGCAGGTTGGAGTTCTCCTGG + Intronic
955490738 3:59479628-59479650 GCTGCAGGTGGGAGAGCGCCCGG - Intergenic
960055092 3:113271304-113271326 TGGCCACGTGGGAGGCCTCCAGG + Intronic
960487631 3:118272469-118272491 GCGGCAGCTTGGAGATCTCCTGG + Intergenic
960995114 3:123335605-123335627 GAGGGAGGTGGGAGGACCCCTGG + Intronic
961653390 3:128428655-128428677 CCGCCAGGTGGGCAGCCTCCTGG + Intergenic
961885016 3:130091369-130091391 GCTGAGGGTGGGAGGCCTACCGG - Exonic
962373628 3:134841406-134841428 GGGACAGGTGGGAGGTCTCCAGG + Intronic
966878892 3:184338662-184338684 CCGGCACGGGGGCGGCCTCCCGG - Intronic
966886554 3:184380460-184380482 GCGGCAGGTAGGTGGGCGCCCGG + Exonic
966926048 3:184645309-184645331 GGGGCAGGTGGAAGGCCTGGTGG - Intronic
968148251 3:196317903-196317925 GCGGGAGGCGGGAGGCCGCGAGG - Intronic
968233558 3:197017974-197017996 GGGGCAGGGGGCAGGGCTCCCGG + Intronic
968591516 4:1462130-1462152 GGGGCGGGAGGGAAGCCTCCTGG - Intergenic
968606818 4:1539417-1539439 ACGGCAGCTGGGGGGGCTCCAGG - Intergenic
968706608 4:2081258-2081280 CTGGCAGGGGTGAGGCCTCCAGG - Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968946371 4:3666746-3666768 GGGGCCGGTGGGAGGCTTCCTGG + Intergenic
969359779 4:6656201-6656223 AGGACAGGAGGGAGGCCTCCAGG - Intergenic
969878335 4:10152634-10152656 GCTGCATGTGAGAGGCCTCTCGG + Intergenic
970996024 4:22268601-22268623 GAACCAGGTGAGAGGCCTCCTGG + Intergenic
973626602 4:52778790-52778812 GCTGGAGGTGGGAGGCCTGGTGG - Intergenic
977667154 4:99654427-99654449 GAGGGAGGTGGGAAGGCTCCTGG + Exonic
981003670 4:139853398-139853420 AGGGCAGGTGGGGGGCCTGCAGG + Intronic
981429832 4:144645983-144646005 GCCGCAGCAGGGAGGCCGCCGGG + Intergenic
982396080 4:154917419-154917441 GCTGCAGGTGGTAGGTTTCCAGG - Intergenic
983833674 4:172363327-172363349 GTGGCAGGTGGGAGGGTTTCAGG - Intronic
985475662 5:77611-77633 GTGGCAGGTGTGCGGCCTGCAGG + Intergenic
985631636 5:1017158-1017180 GGGGCAGCAGGGAGGCCACCAGG - Intronic
985667014 5:1186572-1186594 TGGGGAGGTGGGAGGCCTCAGGG + Intergenic
985791481 5:1930802-1930824 GCAGCTGCTGGGCGGCCTCCCGG + Intergenic
985833804 5:2256426-2256448 GGGGCAGGATGGAGGCCCCCAGG + Intergenic
989966884 5:50475307-50475329 GTGGCAGGTAGGAGCCCTCATGG + Intergenic
992153188 5:73926605-73926627 GCTGCATGTGGCAGGCCTTCTGG - Intronic
994043461 5:95284130-95284152 GCAGCGGGAGGGACGCCTCCTGG - Exonic
994411397 5:99410737-99410759 GCGGCAGGCTGAAGGGCTCCTGG + Intergenic
994482430 5:100354510-100354532 GCGGCAGGCTGAAGGGCTCCTGG - Intergenic
997259642 5:132455994-132456016 GGAGGAGGTGGGAGGGCTCCTGG - Intronic
997440795 5:133907425-133907447 GGGGAAGGTGGAAGGCCTCTGGG - Intergenic
998158132 5:139797478-139797500 GCTGCAGCGGGGAGGCCTCTGGG - Intronic
998816689 5:146021692-146021714 GAGAGAGGTGGGAGGCCTTCTGG - Intronic
999652681 5:153783022-153783044 GCTGGAGGTGGGAGACCTGCAGG + Intronic
1001035438 5:168292954-168292976 GATGGAGGTGAGAGGCCTCCCGG + Intronic
1001245263 5:170101363-170101385 GAGGCAGGTGGGAGCCAGCCTGG - Intergenic
1002805860 6:573387-573409 GAGGCAGGTGGGAGGCAGCAGGG - Intronic
1002913721 6:1511288-1511310 GAGTCGGGTGGGAGTCCTCCTGG - Intergenic
1003201132 6:3961647-3961669 CCGGCATGTGTGAGGCTTCCAGG - Intergenic
1005725929 6:28648825-28648847 GCGACAGCTGGGAGGCGACCTGG + Intergenic
1006174870 6:32115759-32115781 GGGGCTGGTGGGAGGCCTGGTGG + Exonic
1006490819 6:34386095-34386117 TTGGCAGCTGGGAGGCCACCTGG + Intronic
1013638731 6:112053092-112053114 CAGGCAGGTGGGACGCCTCAGGG + Intergenic
1016892462 6:149020292-149020314 GGGGCAGGGGAGAGGCCACCTGG - Intronic
1017757582 6:157542688-157542710 GTGGCTCGTGGGAGGACTCCGGG - Exonic
1019082107 6:169441435-169441457 GCGGCAGGTGGGAAGCACCGAGG + Intergenic
1019550308 7:1599139-1599161 GGGCCAGGTTGGAGCCCTCCAGG + Intergenic
1019603902 7:1898975-1898997 GAGGCAGGCAGGAGGCCACCGGG + Intronic
1019693605 7:2432210-2432232 GCTCCAGGTGTGAGCCCTCCTGG - Intronic
1020091463 7:5344584-5344606 GGGGCAGCTGGGGGGCCTTCAGG + Intronic
1020212442 7:6166693-6166715 GCTGCAGGTGGGAGGAAGCCTGG + Intronic
1020983507 7:15102436-15102458 GGGGCAGGTGGGATGCTTTCTGG - Intergenic
1023939669 7:44761504-44761526 GCTGCAGGCGGAAGGGCTCCAGG - Exonic
1026308974 7:69167382-69167404 GTGGCAGGTGTGAGTCCTCAAGG - Intergenic
1026771709 7:73205580-73205602 GAGCCAGGTGGGAGCCTTCCCGG + Intergenic
1026909552 7:74084127-74084149 GAGGCAGGGGCGCGGCCTCCTGG - Intronic
1027012577 7:74758977-74758999 GAGCCAGGTGGGAGCCTTCCCGG + Intronic
1027075463 7:75187076-75187098 GAGCCAGGTGGGAGCCTTCCCGG - Intergenic
1032066935 7:128778902-128778924 GCCGCAGGTGGGAGTCCTGGTGG + Intergenic
1032324776 7:130917062-130917084 GTGGCAGTTTGGAGGCTTCCCGG + Intergenic
1032457904 7:132087536-132087558 GCTGGAGGTGGGAAGCCCCCTGG - Intergenic
1032637321 7:133723862-133723884 GAGGCAGGTGGGAGGACTGTTGG - Intronic
1034346482 7:150388447-150388469 GCTGATGCTGGGAGGCCTCCAGG + Exonic
1034418778 7:150978359-150978381 GCGGCAGGCGGGAGGGGGCCGGG - Intergenic
1035221878 7:157411032-157411054 ACGGCAGGTGGGCGGCCGGCTGG - Intronic
1035235600 7:157495873-157495895 GTGGCAGGTGGGAAACCCCCTGG + Intergenic
1035283100 7:157789464-157789486 GAGGCTCGTGGGAGGCCTCCAGG + Intronic
1035420588 7:158726464-158726486 GCAGCAGGTGGGAGACCAACTGG - Intergenic
1035700727 8:1637890-1637912 CCTGCAGGCGGAAGGCCTCCCGG - Intronic
1035702650 8:1648515-1648537 GAGGCATCTGGGAAGCCTCCTGG + Intronic
1036656690 8:10681595-10681617 GCCACAGGTGGGACACCTCCAGG - Intronic
1036766699 8:11553977-11553999 GCGGCAGGCTGGGGGGCTCCCGG - Intronic
1039915784 8:41859217-41859239 GCGGCAGGTGGGAGGACGATGGG + Intronic
1040587611 8:48757930-48757952 GCGGGAGGAGGGTGGCCTCTGGG + Intergenic
1042654978 8:71085872-71085894 GGGGCAGGTGGGGGGCATACAGG + Intergenic
1045556775 8:103222028-103222050 GTGGCGGGTGGGGGGCTTCCAGG + Intronic
1046620625 8:116525904-116525926 GAGGCAGCTGGGAGGCAGCCAGG + Intergenic
1048906325 8:139092841-139092863 GCGGGAGGTGGGTGGACTTCTGG + Intergenic
1049241872 8:141541892-141541914 CCAGCAGGTGGGAGTCCTCCTGG - Intergenic
1049463166 8:142739386-142739408 AGGGCAGGTGGGCGTCCTCCAGG + Intergenic
1049553774 8:143272396-143272418 GCGGCAGGTGGGTGCTTTCCTGG - Intronic
1049597201 8:143490192-143490214 TCAGCAGCTGGGAGGCCCCCCGG + Intronic
1049655261 8:143794387-143794409 GCGCCAAGAGGGAGGCTTCCGGG - Intronic
1049660486 8:143817635-143817657 GCGGCAGGTGGGAGGCCTCCAGG + Exonic
1054808304 9:69413297-69413319 GAGCCAGGTGGGCAGCCTCCGGG - Intergenic
1056737929 9:89225714-89225736 GCTGCAGGAGGCAGGCGTCCAGG - Intergenic
1057472347 9:95368917-95368939 CCAGCAGGTGGGCCGCCTCCCGG + Intergenic
1057478658 9:95426845-95426867 GCCGCGGGGGAGAGGCCTCCGGG - Intergenic
1057930965 9:99192599-99192621 GCAGCAGCTTGGAGGTCTCCAGG - Intergenic
1058861251 9:109119664-109119686 GCGGCCGCAGGAAGGCCTCCAGG + Exonic
1060109190 9:120894514-120894536 GAGGCGGGTGGGAGGCGTCGTGG - Intronic
1060405499 9:123371032-123371054 GTGCCAGGTGTGAGGCCTGCAGG - Intronic
1061185127 9:129048544-129048566 GCAGCAGGTGCCAGGGCTCCAGG + Intronic
1061293936 9:129666960-129666982 GGGGCGGGTGGGAGGGCTGCTGG - Intronic
1061374136 9:130214216-130214238 GCCCCAGGTCTGAGGCCTCCGGG - Intronic
1061618696 9:131796756-131796778 GCTGTCGGTGGGGGGCCTCCTGG - Intergenic
1061628937 9:131859360-131859382 GCTGCAGGTGGGATGCCACGTGG + Intergenic
1062046358 9:134426284-134426306 GCTGCAGGAAGGAGGGCTCCTGG - Intronic
1062310440 9:135932831-135932853 GCAGCATGTGGGAGGCCTTGTGG - Intergenic
1062325642 9:136011211-136011233 GGGGAGGGTGGGAGGCCGCCAGG - Exonic
1062399645 9:136366755-136366777 GGGGAAGCTGGGAGGCCTCTGGG + Intronic
1062501553 9:136854106-136854128 TGGGCAGGTGGGGGCCCTCCCGG - Intronic
1062734582 9:138128202-138128224 GCAGCAGGTGGGAGCGCTCAGGG - Intergenic
1186385757 X:9108815-9108837 TCTGGAAGTGGGAGGCCTCCCGG - Intronic
1188244662 X:27825241-27825263 GCTAAAGGTGGGAGGACTCCAGG - Intergenic
1199635132 X:149806575-149806597 GCGGGAGGTGGGAGGTCTCAGGG + Intergenic