ID: 1049662849 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:143828128-143828150 |
Sequence | CTGGGCTGCCCTCGCAAGCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1049662847_1049662849 | -8 | Left | 1049662847 | 8:143828113-143828135 | CCTGTGAATCACACACTGGGCTG | No data | ||
Right | 1049662849 | 8:143828128-143828150 | CTGGGCTGCCCTCGCAAGCTGGG | No data | ||||
1049662844_1049662849 | -3 | Left | 1049662844 | 8:143828108-143828130 | CCAGTCCTGTGAATCACACACTG | No data | ||
Right | 1049662849 | 8:143828128-143828150 | CTGGGCTGCCCTCGCAAGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1049662849 | Original CRISPR | CTGGGCTGCCCTCGCAAGCT GGG | Intronic | ||