ID: 1049662849

View in Genome Browser
Species Human (GRCh38)
Location 8:143828128-143828150
Sequence CTGGGCTGCCCTCGCAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049662847_1049662849 -8 Left 1049662847 8:143828113-143828135 CCTGTGAATCACACACTGGGCTG No data
Right 1049662849 8:143828128-143828150 CTGGGCTGCCCTCGCAAGCTGGG No data
1049662844_1049662849 -3 Left 1049662844 8:143828108-143828130 CCAGTCCTGTGAATCACACACTG No data
Right 1049662849 8:143828128-143828150 CTGGGCTGCCCTCGCAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049662849 Original CRISPR CTGGGCTGCCCTCGCAAGCT GGG Intronic