ID: 1049671358

View in Genome Browser
Species Human (GRCh38)
Location 8:143871488-143871510
Sequence CTGTACGAGCGGCTGGAGCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049671358_1049671365 16 Left 1049671358 8:143871488-143871510 CCATGCTCCAGCCGCTCGTACAG 0: 1
1: 0
2: 1
3: 5
4: 89
Right 1049671365 8:143871527-143871549 TCGGCTTTCAGCAGCTCTCCTGG 0: 1
1: 0
2: 3
3: 12
4: 142
1049671358_1049671366 24 Left 1049671358 8:143871488-143871510 CCATGCTCCAGCCGCTCGTACAG 0: 1
1: 0
2: 1
3: 5
4: 89
Right 1049671366 8:143871535-143871557 CAGCAGCTCTCCTGGTGTCACGG 0: 1
1: 0
2: 3
3: 17
4: 243
1049671358_1049671363 -3 Left 1049671358 8:143871488-143871510 CCATGCTCCAGCCGCTCGTACAG 0: 1
1: 0
2: 1
3: 5
4: 89
Right 1049671363 8:143871508-143871530 CAGGTCCTGGTCGATGATCTCGG 0: 1
1: 0
2: 0
3: 14
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049671358 Original CRISPR CTGTACGAGCGGCTGGAGCA TGG (reversed) Exonic
900201030 1:1406681-1406703 CCGGGCGAGGGGCTGGAGCAGGG + Intronic
903855698 1:26336606-26336628 CTGTAGGACCGGCTGCAGCGAGG + Exonic
905175825 1:36134759-36134781 CTGTAGGGGTGGCTGGAGGAGGG + Intergenic
906047868 1:42846636-42846658 CTGATCGAGCGGCGGGAGCGAGG + Exonic
907515290 1:54989843-54989865 CTCTAAGTGGGGCTGGAGCATGG + Intronic
910850222 1:91642502-91642524 CAGACCGTGCGGCTGGAGCAAGG + Intergenic
912372634 1:109185731-109185753 CTGTATGAGAGGCTGGAGAGAGG + Intronic
912865345 1:113251350-113251372 CTGCACGAGTGACTGGAGAAGGG - Intergenic
913975266 1:143450579-143450601 CTATACCAGCAGCTGGTGCAGGG - Intergenic
914069659 1:144276195-144276217 CTGTACCAGCAGCTGGCGCAGGG - Intergenic
914109496 1:144690159-144690181 CTGTACCAGCAGCTGGCGCAGGG + Intergenic
916969518 1:169996762-169996784 CTGTACGATCTGCTGGACCTGGG + Intronic
917489212 1:175483390-175483412 CTGTAAGAGCAGGTGGGGCAGGG + Intronic
923520358 1:234730718-234730740 CTGTAGGAGCTGGTGCAGCATGG - Intergenic
1066240976 10:33534590-33534612 ATGTACCAGGGGCTGGAGGATGG + Intergenic
1076724873 10:132408593-132408615 CTGCAGGAGCGGCTGGGGCCAGG - Intronic
1077222094 11:1422310-1422332 GTGGAGGAGCGGCTGGAGGAGGG - Intronic
1079190428 11:18272502-18272524 CTGTAGCAGTGGCTGGAGAAAGG + Intergenic
1082787733 11:57326094-57326116 CTGTTCAAGTTGCTGGAGCAGGG - Exonic
1084033324 11:66493589-66493611 CTGCACGAGCTGCTGGGCCATGG + Exonic
1084472787 11:69373002-69373024 GAGTCCGGGCGGCTGGAGCAGGG + Intergenic
1084549579 11:69833153-69833175 CTGTCCCAGCTGCTGGTGCACGG + Intergenic
1089610625 11:119666660-119666682 CTTTACGTGGGCCTGGAGCAAGG - Intronic
1090762494 11:129849588-129849610 CTGTATGAGCTGTGGGAGCACGG - Intronic
1091775311 12:3181122-3181144 ATGTGCGAGCGGCTGGCGCCCGG + Intronic
1092029877 12:5275276-5275298 CTGTGCCACAGGCTGGAGCAGGG - Intergenic
1099955802 12:89351951-89351973 CTCAACGAGCAGCTGGAGCTGGG - Exonic
1101737571 12:107474546-107474568 CTGTACCTGGGGCTGGACCATGG + Intronic
1104757575 12:131278733-131278755 CTGACCGAGGGGCTGGATCAGGG - Intergenic
1104934355 12:132356516-132356538 CTGTGCGGGAGGCTGGAGCCTGG + Intergenic
1118636527 14:67753248-67753270 CTGGAGCAGGGGCTGGAGCAGGG - Intronic
1122688204 14:103519901-103519923 ATGGAGCAGCGGCTGGAGCAGGG - Exonic
1125524855 15:40368384-40368406 CTGTTCGAGCAGCTGCCGCAGGG + Exonic
1125579480 15:40775393-40775415 ATCTCCGGGCGGCTGGAGCATGG + Intronic
1126897200 15:53271819-53271841 CTGGAGGAGAGGCAGGAGCATGG - Intergenic
1128572259 15:68742374-68742396 CTGTGCAAGCTGCTGGAGGAAGG - Intergenic
1131389791 15:92037747-92037769 CTGAATGAACTGCTGGAGCAAGG - Intronic
1135607324 16:23835981-23836003 CTGGACGAGCGGCAGCAGCTGGG + Intronic
1135932416 16:26749669-26749691 CTGTGTGAGGGGCTGGAGAAGGG - Intergenic
1141260446 16:82448840-82448862 CAGTAAGCACGGCTGGAGCAGGG - Intergenic
1141289338 16:82703362-82703384 TTGTTCTAGCTGCTGGAGCATGG + Intronic
1143558274 17:7676125-7676147 GTGTAGGAGCTGCTGGTGCAGGG + Exonic
1147460300 17:40564036-40564058 CAGTATGAAAGGCTGGAGCAGGG + Intronic
1147874328 17:43610303-43610325 CTGTGCAAGCTGCTGGAGGACGG - Intergenic
1154311947 18:13273790-13273812 CTGCATGAGGGGCTGGAGGATGG - Intronic
1158653127 18:59305506-59305528 CTGGACGTGCAGCTGGAGCAGGG + Intronic
1162771023 19:12949365-12949387 CTGGCCCAGCTGCTGGAGCAGGG - Exonic
1163026900 19:14517936-14517958 CTGGCCGAGCGGCTGGGCCAAGG + Intronic
1163783397 19:19261888-19261910 CTGGAGGAGCGGCGGCAGCAAGG + Intronic
1165756957 19:38299183-38299205 CTGGAAAAGCGGCTGCAGCAAGG - Intronic
927695506 2:25236949-25236971 CTGCAGGAGTGTCTGGAGCATGG - Exonic
934179966 2:89611552-89611574 CTATACCAGCAGCTGGCGCAGGG - Intergenic
934290262 2:91685813-91685835 CTATACCAGCAGCTGGCGCAGGG - Intergenic
937078430 2:119123891-119123913 GTGTATGAGTGGCTGGTGCATGG + Intergenic
1170648770 20:18220073-18220095 CTGCACGGGAGTCTGGAGCAGGG - Intergenic
1171491754 20:25524400-25524422 CTGTAGGAGGGGATGGAGCTGGG + Intronic
1175938623 20:62526780-62526802 CAGTACCAGCGGCTAAAGCAGGG - Intergenic
1184893426 22:47393258-47393280 GTGCACCAGGGGCTGGAGCAGGG + Intergenic
950502368 3:13372618-13372640 CTGGTAGAGCGGCTGGAGCCAGG + Intronic
952372908 3:32740346-32740368 CTATTCGAGAGGCTGAAGCAGGG + Intronic
953791654 3:45952154-45952176 GTGTAAGAGCAGCTGGTGCAAGG + Intronic
954174145 3:48830090-48830112 CTGCTCGAGAGGCTGGGGCAAGG + Intronic
961170826 3:124796679-124796701 CTGCACGTGCGGCTGCAGCGTGG - Exonic
964096030 3:152932863-152932885 CTGTATGACCTCCTGGAGCAGGG + Intergenic
968172580 3:196522501-196522523 CAGTTTGAGCTGCTGGAGCAGGG - Intergenic
968768187 4:2485844-2485866 CTGGACGAGAGACTGGAGGATGG + Intronic
969626085 4:8306484-8306506 CAGTAGGAGGGGCAGGAGCAGGG - Exonic
969829315 4:9782078-9782100 CTATACCAGCAGCTGGCGCAGGG + Exonic
976734637 4:88297076-88297098 CTGCAGCAGCGGCTGCAGCAAGG - Intergenic
976745236 4:88396360-88396382 CTGTACCAGGTGCTGGAGAATGG + Intronic
978587842 4:110292669-110292691 CTCTTTGAGCGGCTGCAGCATGG - Intergenic
981748283 4:148071266-148071288 CTGGAGGGGCGGCTGGAGCCAGG + Intronic
986123717 5:4866706-4866728 CTCCACGAGCAGCTGGAGCCCGG - Intergenic
986131686 5:4937873-4937895 CTGAAGGAGCAGGTGGAGCATGG - Intergenic
988730716 5:33970156-33970178 CTGCAGCAGCTGCTGGAGCAAGG - Intronic
1001492351 5:172164831-172164853 CTCTCCCAGCGGCTGAAGCAAGG + Intronic
1003325319 6:5086069-5086091 CTGGAAGAGCGGCCGGAGCCGGG - Exonic
1004168351 6:13276206-13276228 CTGTAGGGTAGGCTGGAGCAGGG + Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1007319446 6:41016679-41016701 GTGTACGAGAGGCTGAAGCAGGG + Intergenic
1015484901 6:133758299-133758321 CTGTTGGAGAGGCTGGAGAAAGG - Intergenic
1017163891 6:151390687-151390709 CTGTAGGAGCCGCTGCAGCTGGG + Intronic
1018197318 6:161366691-161366713 GTGTATGAGTGGCTGAAGCATGG - Intronic
1019667115 7:2257489-2257511 CTGTGCGAGCGGCATGAGAAGGG - Exonic
1022701227 7:32762142-32762164 CTGTACGTGCAGCTGCCGCAAGG - Intergenic
1027192152 7:76002965-76002987 CTGTACCAGGGGCTGGAGCATGG - Intronic
1033273702 7:139955606-139955628 CTGTAAGTGCGGCTGCAGCCCGG + Exonic
1045113100 8:98951811-98951833 CTGCAGGTGCGGCTGCAGCAAGG - Exonic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1049296547 8:141843504-141843526 CTGAATGAGCAGCAGGAGCAGGG + Intergenic
1049671358 8:143871488-143871510 CTGTACGAGCGGCTGGAGCATGG - Exonic
1058598096 9:106637725-106637747 CTGTACAAGCTGTGGGAGCAGGG + Intergenic
1062526763 9:136981069-136981091 CTGTCCCAGTGGCTGGAACAGGG + Intronic
1187648307 X:21374076-21374098 AGGTGCGGGCGGCTGGAGCATGG - Intergenic
1188286811 X:28336558-28336580 CTGTAAAAGCTGCTGGAGCAGGG + Intergenic
1192559133 X:72113922-72113944 CTGTATGAGGGGCTGGACTAGGG + Intergenic