ID: 1049673293

View in Genome Browser
Species Human (GRCh38)
Location 8:143879010-143879032
Sequence GAACATTCTCTGTGCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049673293_1049673304 24 Left 1049673293 8:143879010-143879032 CCACCTGGGCACAGAGAATGTTC No data
Right 1049673304 8:143879057-143879079 CCCCTCTCTGAAGCCCATCCTGG No data
1049673293_1049673296 -9 Left 1049673293 8:143879010-143879032 CCACCTGGGCACAGAGAATGTTC No data
Right 1049673296 8:143879024-143879046 AGAATGTTCCCTGTCACCCTGGG No data
1049673293_1049673299 0 Left 1049673293 8:143879010-143879032 CCACCTGGGCACAGAGAATGTTC No data
Right 1049673299 8:143879033-143879055 CCTGTCACCCTGGGAGTACCTGG No data
1049673293_1049673295 -10 Left 1049673293 8:143879010-143879032 CCACCTGGGCACAGAGAATGTTC No data
Right 1049673295 8:143879023-143879045 GAGAATGTTCCCTGTCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049673293 Original CRISPR GAACATTCTCTGTGCCCAGG TGG (reversed) Intergenic