ID: 1049673294

View in Genome Browser
Species Human (GRCh38)
Location 8:143879013-143879035
Sequence AGGGAACATTCTCTGTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049673294_1049673299 -3 Left 1049673294 8:143879013-143879035 CCTGGGCACAGAGAATGTTCCCT No data
Right 1049673299 8:143879033-143879055 CCTGTCACCCTGGGAGTACCTGG No data
1049673294_1049673304 21 Left 1049673294 8:143879013-143879035 CCTGGGCACAGAGAATGTTCCCT No data
Right 1049673304 8:143879057-143879079 CCCCTCTCTGAAGCCCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049673294 Original CRISPR AGGGAACATTCTCTGTGCCC AGG (reversed) Intergenic