ID: 1049673296

View in Genome Browser
Species Human (GRCh38)
Location 8:143879024-143879046
Sequence AGAATGTTCCCTGTCACCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049673284_1049673296 14 Left 1049673284 8:143878987-143879009 CCTCACCCCCCGGTCTGGCTCCT No data
Right 1049673296 8:143879024-143879046 AGAATGTTCCCTGTCACCCTGGG No data
1049673293_1049673296 -9 Left 1049673293 8:143879010-143879032 CCACCTGGGCACAGAGAATGTTC No data
Right 1049673296 8:143879024-143879046 AGAATGTTCCCTGTCACCCTGGG No data
1049673292_1049673296 -6 Left 1049673292 8:143879007-143879029 CCTCCACCTGGGCACAGAGAATG No data
Right 1049673296 8:143879024-143879046 AGAATGTTCCCTGTCACCCTGGG No data
1049673290_1049673296 5 Left 1049673290 8:143878996-143879018 CCGGTCTGGCTCCTCCACCTGGG No data
Right 1049673296 8:143879024-143879046 AGAATGTTCCCTGTCACCCTGGG No data
1049673286_1049673296 8 Left 1049673286 8:143878993-143879015 CCCCCGGTCTGGCTCCTCCACCT No data
Right 1049673296 8:143879024-143879046 AGAATGTTCCCTGTCACCCTGGG No data
1049673282_1049673296 19 Left 1049673282 8:143878982-143879004 CCAGGCCTCACCCCCCGGTCTGG No data
Right 1049673296 8:143879024-143879046 AGAATGTTCCCTGTCACCCTGGG No data
1049673287_1049673296 7 Left 1049673287 8:143878994-143879016 CCCCGGTCTGGCTCCTCCACCTG No data
Right 1049673296 8:143879024-143879046 AGAATGTTCCCTGTCACCCTGGG No data
1049673288_1049673296 6 Left 1049673288 8:143878995-143879017 CCCGGTCTGGCTCCTCCACCTGG No data
Right 1049673296 8:143879024-143879046 AGAATGTTCCCTGTCACCCTGGG No data
1049673285_1049673296 9 Left 1049673285 8:143878992-143879014 CCCCCCGGTCTGGCTCCTCCACC No data
Right 1049673296 8:143879024-143879046 AGAATGTTCCCTGTCACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049673296 Original CRISPR AGAATGTTCCCTGTCACCCT GGG Intergenic