ID: 1049673297

View in Genome Browser
Species Human (GRCh38)
Location 8:143879032-143879054
Sequence CAGGTACTCCCAGGGTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049673297_1049673312 23 Left 1049673297 8:143879032-143879054 CCCTGTCACCCTGGGAGTACCTG No data
Right 1049673312 8:143879078-143879100 GGCACCCACCTTCCAAGGCTGGG No data
1049673297_1049673304 2 Left 1049673297 8:143879032-143879054 CCCTGTCACCCTGGGAGTACCTG No data
Right 1049673304 8:143879057-143879079 CCCCTCTCTGAAGCCCATCCTGG No data
1049673297_1049673309 18 Left 1049673297 8:143879032-143879054 CCCTGTCACCCTGGGAGTACCTG No data
Right 1049673309 8:143879073-143879095 ATCCTGGCACCCACCTTCCAAGG No data
1049673297_1049673311 22 Left 1049673297 8:143879032-143879054 CCCTGTCACCCTGGGAGTACCTG No data
Right 1049673311 8:143879077-143879099 TGGCACCCACCTTCCAAGGCTGG No data
1049673297_1049673313 24 Left 1049673297 8:143879032-143879054 CCCTGTCACCCTGGGAGTACCTG No data
Right 1049673313 8:143879079-143879101 GCACCCACCTTCCAAGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049673297 Original CRISPR CAGGTACTCCCAGGGTGACA GGG (reversed) Intergenic