ID: 1049673300

View in Genome Browser
Species Human (GRCh38)
Location 8:143879040-143879062
Sequence GAGGGGACCAGGTACTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049673300_1049673311 14 Left 1049673300 8:143879040-143879062 CCCTGGGAGTACCTGGTCCCCTC No data
Right 1049673311 8:143879077-143879099 TGGCACCCACCTTCCAAGGCTGG No data
1049673300_1049673304 -6 Left 1049673300 8:143879040-143879062 CCCTGGGAGTACCTGGTCCCCTC No data
Right 1049673304 8:143879057-143879079 CCCCTCTCTGAAGCCCATCCTGG No data
1049673300_1049673309 10 Left 1049673300 8:143879040-143879062 CCCTGGGAGTACCTGGTCCCCTC No data
Right 1049673309 8:143879073-143879095 ATCCTGGCACCCACCTTCCAAGG No data
1049673300_1049673312 15 Left 1049673300 8:143879040-143879062 CCCTGGGAGTACCTGGTCCCCTC No data
Right 1049673312 8:143879078-143879100 GGCACCCACCTTCCAAGGCTGGG No data
1049673300_1049673313 16 Left 1049673300 8:143879040-143879062 CCCTGGGAGTACCTGGTCCCCTC No data
Right 1049673313 8:143879079-143879101 GCACCCACCTTCCAAGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049673300 Original CRISPR GAGGGGACCAGGTACTCCCA GGG (reversed) Intergenic