ID: 1049673304

View in Genome Browser
Species Human (GRCh38)
Location 8:143879057-143879079
Sequence CCCCTCTCTGAAGCCCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049673292_1049673304 27 Left 1049673292 8:143879007-143879029 CCTCCACCTGGGCACAGAGAATG No data
Right 1049673304 8:143879057-143879079 CCCCTCTCTGAAGCCCATCCTGG No data
1049673293_1049673304 24 Left 1049673293 8:143879010-143879032 CCACCTGGGCACAGAGAATGTTC No data
Right 1049673304 8:143879057-143879079 CCCCTCTCTGAAGCCCATCCTGG No data
1049673297_1049673304 2 Left 1049673297 8:143879032-143879054 CCCTGTCACCCTGGGAGTACCTG No data
Right 1049673304 8:143879057-143879079 CCCCTCTCTGAAGCCCATCCTGG No data
1049673298_1049673304 1 Left 1049673298 8:143879033-143879055 CCTGTCACCCTGGGAGTACCTGG No data
Right 1049673304 8:143879057-143879079 CCCCTCTCTGAAGCCCATCCTGG No data
1049673301_1049673304 -7 Left 1049673301 8:143879041-143879063 CCTGGGAGTACCTGGTCCCCTCT No data
Right 1049673304 8:143879057-143879079 CCCCTCTCTGAAGCCCATCCTGG No data
1049673294_1049673304 21 Left 1049673294 8:143879013-143879035 CCTGGGCACAGAGAATGTTCCCT No data
Right 1049673304 8:143879057-143879079 CCCCTCTCTGAAGCCCATCCTGG No data
1049673300_1049673304 -6 Left 1049673300 8:143879040-143879062 CCCTGGGAGTACCTGGTCCCCTC No data
Right 1049673304 8:143879057-143879079 CCCCTCTCTGAAGCCCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049673304 Original CRISPR CCCCTCTCTGAAGCCCATCC TGG Intergenic