ID: 1049673306

View in Genome Browser
Species Human (GRCh38)
Location 8:143879059-143879081
Sequence TGCCAGGATGGGCTTCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049673306_1049673319 15 Left 1049673306 8:143879059-143879081 CCTCTCTGAAGCCCATCCTGGCA No data
Right 1049673319 8:143879097-143879119 TGGGGCATGCCAGAGACACTGGG No data
1049673306_1049673311 -5 Left 1049673306 8:143879059-143879081 CCTCTCTGAAGCCCATCCTGGCA No data
Right 1049673311 8:143879077-143879099 TGGCACCCACCTTCCAAGGCTGG No data
1049673306_1049673321 23 Left 1049673306 8:143879059-143879081 CCTCTCTGAAGCCCATCCTGGCA No data
Right 1049673321 8:143879105-143879127 GCCAGAGACACTGGGCATGGAGG No data
1049673306_1049673312 -4 Left 1049673306 8:143879059-143879081 CCTCTCTGAAGCCCATCCTGGCA No data
Right 1049673312 8:143879078-143879100 GGCACCCACCTTCCAAGGCTGGG No data
1049673306_1049673309 -9 Left 1049673306 8:143879059-143879081 CCTCTCTGAAGCCCATCCTGGCA No data
Right 1049673309 8:143879073-143879095 ATCCTGGCACCCACCTTCCAAGG No data
1049673306_1049673320 20 Left 1049673306 8:143879059-143879081 CCTCTCTGAAGCCCATCCTGGCA No data
Right 1049673320 8:143879102-143879124 CATGCCAGAGACACTGGGCATGG No data
1049673306_1049673313 -3 Left 1049673306 8:143879059-143879081 CCTCTCTGAAGCCCATCCTGGCA No data
Right 1049673313 8:143879079-143879101 GCACCCACCTTCCAAGGCTGGGG No data
1049673306_1049673318 14 Left 1049673306 8:143879059-143879081 CCTCTCTGAAGCCCATCCTGGCA No data
Right 1049673318 8:143879096-143879118 CTGGGGCATGCCAGAGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049673306 Original CRISPR TGCCAGGATGGGCTTCAGAG AGG (reversed) Intergenic