ID: 1049673309

View in Genome Browser
Species Human (GRCh38)
Location 8:143879073-143879095
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049673306_1049673309 -9 Left 1049673306 8:143879059-143879081 CCTCTCTGAAGCCCATCCTGGCA No data
Right 1049673309 8:143879073-143879095 ATCCTGGCACCCACCTTCCAAGG No data
1049673297_1049673309 18 Left 1049673297 8:143879032-143879054 CCCTGTCACCCTGGGAGTACCTG No data
Right 1049673309 8:143879073-143879095 ATCCTGGCACCCACCTTCCAAGG No data
1049673305_1049673309 -8 Left 1049673305 8:143879058-143879080 CCCTCTCTGAAGCCCATCCTGGC No data
Right 1049673309 8:143879073-143879095 ATCCTGGCACCCACCTTCCAAGG No data
1049673303_1049673309 -7 Left 1049673303 8:143879057-143879079 CCCCTCTCTGAAGCCCATCCTGG No data
Right 1049673309 8:143879073-143879095 ATCCTGGCACCCACCTTCCAAGG No data
1049673301_1049673309 9 Left 1049673301 8:143879041-143879063 CCTGGGAGTACCTGGTCCCCTCT No data
Right 1049673309 8:143879073-143879095 ATCCTGGCACCCACCTTCCAAGG No data
1049673302_1049673309 -1 Left 1049673302 8:143879051-143879073 CCTGGTCCCCTCTCTGAAGCCCA No data
Right 1049673309 8:143879073-143879095 ATCCTGGCACCCACCTTCCAAGG No data
1049673298_1049673309 17 Left 1049673298 8:143879033-143879055 CCTGTCACCCTGGGAGTACCTGG No data
Right 1049673309 8:143879073-143879095 ATCCTGGCACCCACCTTCCAAGG No data
1049673300_1049673309 10 Left 1049673300 8:143879040-143879062 CCCTGGGAGTACCTGGTCCCCTC No data
Right 1049673309 8:143879073-143879095 ATCCTGGCACCCACCTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049673309 Original CRISPR ATCCTGGCACCCACCTTCCA AGG Intergenic