ID: 1049676188

View in Genome Browser
Species Human (GRCh38)
Location 8:143890336-143890358
Sequence CTGGAGCCGCTCCTGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049676188_1049676195 0 Left 1049676188 8:143890336-143890358 CCAGCAGCCAGGAGCGGCTCCAG No data
Right 1049676195 8:143890359-143890381 CAAGGGCCAGGCTGTGACCAGGG No data
1049676188_1049676194 -1 Left 1049676188 8:143890336-143890358 CCAGCAGCCAGGAGCGGCTCCAG No data
Right 1049676194 8:143890358-143890380 GCAAGGGCCAGGCTGTGACCAGG No data
1049676188_1049676196 4 Left 1049676188 8:143890336-143890358 CCAGCAGCCAGGAGCGGCTCCAG No data
Right 1049676196 8:143890363-143890385 GGCCAGGCTGTGACCAGGGCTGG No data
1049676188_1049676199 28 Left 1049676188 8:143890336-143890358 CCAGCAGCCAGGAGCGGCTCCAG No data
Right 1049676199 8:143890387-143890409 TCAGACACCGCCGTGATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049676188 Original CRISPR CTGGAGCCGCTCCTGGCTGC TGG (reversed) Intergenic
No off target data available for this crispr