ID: 1049676348

View in Genome Browser
Species Human (GRCh38)
Location 8:143890988-143891010
Sequence CCGGGCCCCTCCTGACGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049676344_1049676348 1 Left 1049676344 8:143890964-143890986 CCTGTGTTCAGGTGGGCTGCGAC No data
Right 1049676348 8:143890988-143891010 CCGGGCCCCTCCTGACGTCCTGG No data
1049676338_1049676348 11 Left 1049676338 8:143890954-143890976 CCCAGCGTCCCCTGTGTTCAGGT No data
Right 1049676348 8:143890988-143891010 CCGGGCCCCTCCTGACGTCCTGG No data
1049676336_1049676348 12 Left 1049676336 8:143890953-143890975 CCCCAGCGTCCCCTGTGTTCAGG No data
Right 1049676348 8:143890988-143891010 CCGGGCCCCTCCTGACGTCCTGG No data
1049676339_1049676348 10 Left 1049676339 8:143890955-143890977 CCAGCGTCCCCTGTGTTCAGGTG No data
Right 1049676348 8:143890988-143891010 CCGGGCCCCTCCTGACGTCCTGG No data
1049676343_1049676348 2 Left 1049676343 8:143890963-143890985 CCCTGTGTTCAGGTGGGCTGCGA No data
Right 1049676348 8:143890988-143891010 CCGGGCCCCTCCTGACGTCCTGG No data
1049676342_1049676348 3 Left 1049676342 8:143890962-143890984 CCCCTGTGTTCAGGTGGGCTGCG No data
Right 1049676348 8:143890988-143891010 CCGGGCCCCTCCTGACGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049676348 Original CRISPR CCGGGCCCCTCCTGACGTCC TGG Intergenic
No off target data available for this crispr