ID: 1049679412

View in Genome Browser
Species Human (GRCh38)
Location 8:143910996-143911018
Sequence ACCATGGGGGCCCATGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049679408_1049679412 -10 Left 1049679408 8:143910983-143911005 CCAGAAGACCCTGACCATGGGGG No data
Right 1049679412 8:143910996-143911018 ACCATGGGGGCCCATGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049679412 Original CRISPR ACCATGGGGGCCCATGAAGC TGG Intergenic
No off target data available for this crispr