ID: 1049680048

View in Genome Browser
Species Human (GRCh38)
Location 8:143914081-143914103
Sequence GGAACAGGAGTGGCCCCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049680048_1049680065 24 Left 1049680048 8:143914081-143914103 CCGGCCGGGGCCACTCCTGTTCC No data
Right 1049680065 8:143914128-143914150 TCTACCGGGCCGGGGCAGGGAGG No data
1049680048_1049680058 14 Left 1049680048 8:143914081-143914103 CCGGCCGGGGCCACTCCTGTTCC No data
Right 1049680058 8:143914118-143914140 CAGAGCACCCTCTACCGGGCCGG No data
1049680048_1049680061 20 Left 1049680048 8:143914081-143914103 CCGGCCGGGGCCACTCCTGTTCC No data
Right 1049680061 8:143914124-143914146 ACCCTCTACCGGGCCGGGGCAGG No data
1049680048_1049680052 -9 Left 1049680048 8:143914081-143914103 CCGGCCGGGGCCACTCCTGTTCC No data
Right 1049680052 8:143914095-143914117 TCCTGTTCCAGCGGACCAGCAGG No data
1049680048_1049680057 10 Left 1049680048 8:143914081-143914103 CCGGCCGGGGCCACTCCTGTTCC No data
Right 1049680057 8:143914114-143914136 CAGGCAGAGCACCCTCTACCGGG No data
1049680048_1049680059 15 Left 1049680048 8:143914081-143914103 CCGGCCGGGGCCACTCCTGTTCC No data
Right 1049680059 8:143914119-143914141 AGAGCACCCTCTACCGGGCCGGG No data
1049680048_1049680060 16 Left 1049680048 8:143914081-143914103 CCGGCCGGGGCCACTCCTGTTCC No data
Right 1049680060 8:143914120-143914142 GAGCACCCTCTACCGGGCCGGGG No data
1049680048_1049680056 9 Left 1049680048 8:143914081-143914103 CCGGCCGGGGCCACTCCTGTTCC No data
Right 1049680056 8:143914113-143914135 GCAGGCAGAGCACCCTCTACCGG No data
1049680048_1049680063 21 Left 1049680048 8:143914081-143914103 CCGGCCGGGGCCACTCCTGTTCC No data
Right 1049680063 8:143914125-143914147 CCCTCTACCGGGCCGGGGCAGGG No data
1049680048_1049680066 25 Left 1049680048 8:143914081-143914103 CCGGCCGGGGCCACTCCTGTTCC No data
Right 1049680066 8:143914129-143914151 CTACCGGGCCGGGGCAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049680048 Original CRISPR GGAACAGGAGTGGCCCCGGC CGG (reversed) Intergenic
No off target data available for this crispr