ID: 1049680514

View in Genome Browser
Species Human (GRCh38)
Location 8:143915924-143915946
Sequence CTGTGTGAGTGGCAGGTAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 1, 2: 2, 3: 55, 4: 396}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049680505_1049680514 6 Left 1049680505 8:143915895-143915917 CCCAGCTTGGGACCCTCCAAGGC 0: 1
1: 0
2: 0
3: 17
4: 154
Right 1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG 0: 1
1: 1
2: 2
3: 55
4: 396
1049680509_1049680514 -7 Left 1049680509 8:143915908-143915930 CCTCCAAGGCACCTGGCTGTGTG 0: 1
1: 0
2: 2
3: 32
4: 285
Right 1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG 0: 1
1: 1
2: 2
3: 55
4: 396
1049680510_1049680514 -10 Left 1049680510 8:143915911-143915933 CCAAGGCACCTGGCTGTGTGAGT 0: 1
1: 0
2: 0
3: 27
4: 327
Right 1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG 0: 1
1: 1
2: 2
3: 55
4: 396
1049680508_1049680514 -6 Left 1049680508 8:143915907-143915929 CCCTCCAAGGCACCTGGCTGTGT 0: 1
1: 0
2: 3
3: 18
4: 231
Right 1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG 0: 1
1: 1
2: 2
3: 55
4: 396
1049680506_1049680514 5 Left 1049680506 8:143915896-143915918 CCAGCTTGGGACCCTCCAAGGCA 0: 1
1: 0
2: 2
3: 22
4: 158
Right 1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG 0: 1
1: 1
2: 2
3: 55
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049680514 Original CRISPR CTGTGTGAGTGGCAGGTAGA AGG Exonic
900012777 1:131252-131274 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
900042840 1:487239-487261 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
900064278 1:722230-722252 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
900230608 1:1555144-1555166 CTGTGTGTGTGGCAGGGGCATGG - Intronic
900615359 1:3563249-3563271 ATATGTGAGTGACAGGGAGATGG - Intronic
900877772 1:5357829-5357851 CTCTGAGAGTTGCAGGGAGAGGG - Intergenic
901053534 1:6437863-6437885 GTGTGTGAGAGGGAGGGAGAGGG + Intronic
901685551 1:10941636-10941658 GTGTGTGATTGGCAGGTTTACGG - Intergenic
901936888 1:12633041-12633063 TCGTGTGAGTGGCAGGTAAGTGG + Intergenic
902480741 1:16710281-16710303 GTGTGTGAGAGGGAGGGAGAGGG - Intergenic
902553877 1:17235413-17235435 CGGTATGGGTGGCATGTAGATGG + Intronic
904126272 1:28241906-28241928 CTGGGGGAGTGGGAGGTACATGG + Intronic
905546884 1:38807281-38807303 GTGTGTGTGTGTCAGGGAGAAGG - Intergenic
906057492 1:42928379-42928401 GTGTGTGAGTGCCAGGCACAGGG + Intronic
908250729 1:62263656-62263678 CTGTGTGAGGGGGAAGGAGAGGG - Intronic
908444238 1:64186888-64186910 GTGGGTGAGTGGCAGGTAGCTGG - Intergenic
908445162 1:64192707-64192729 GTGGGTGAGTGGTAGGTAGCTGG - Intergenic
909236715 1:73161975-73161997 CTGTGTGAGGGGGTGGTACAGGG + Intergenic
909308778 1:74118566-74118588 ATGTGTGTGTGGGAGGTAGTGGG - Intronic
909449667 1:75784518-75784540 CTGTGTGTGTGGCGAGGAGAGGG + Intronic
909820637 1:80054533-80054555 ATGGGCGAGTGGCAGGTAGCTGG - Intergenic
910097789 1:83543428-83543450 TTTTGTGAGAGGCAGTTAGAAGG - Intergenic
910189488 1:84581080-84581102 CCCTCTTAGTGGCAGGTAGAGGG - Intergenic
910360034 1:86406800-86406822 CTCTGTGACTGTCAGGTAAAAGG - Intergenic
911096153 1:94056649-94056671 CAGGATGTGTGGCAGGTAGAGGG + Exonic
911462152 1:98204484-98204506 GTATGTGAGTGCAAGGTAGACGG - Intergenic
911746272 1:101445137-101445159 TTGTGTGGGTGGGAGGTAGGGGG - Intergenic
912499764 1:110114105-110114127 GTGTGTGAGTGGGAGGGAGTGGG + Intergenic
912547946 1:110464898-110464920 CTCTGGGAGTGGGAGGTACAAGG - Intergenic
912778853 1:112525367-112525389 TTGGGTGATTGGCAGGTATAGGG + Exonic
912797568 1:112702171-112702193 TTGTGTAAGTGGCTGGAAGAAGG - Intronic
913301657 1:117376537-117376559 GTGGGTGAGTGGCAGGTAGTTGG - Intronic
915457501 1:156050662-156050684 CTGTGGGAATGACAGGAAGAGGG - Intronic
915490296 1:156246840-156246862 CTGTGCGTGTGGGAGGCAGATGG + Intronic
915508197 1:156370657-156370679 CTCTGTGATTAGCAGGTAGATGG - Intronic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
916133635 1:161632427-161632449 CTCTGTGTGTGGCAGGGGGAGGG - Intronic
918123019 1:181556484-181556506 CTGTGGGAGGGGGAGGCAGAGGG + Intronic
918465432 1:184817017-184817039 CAGGGTGAGGGGCAGGTGGAGGG - Intronic
919604652 1:199667061-199667083 GTGGGTGAGTGGCAGGTAGCTGG + Intergenic
922022808 1:221721443-221721465 CTGTGTGAGTTACAGCTGGATGG - Intronic
922099178 1:222468248-222468270 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
922261215 1:223947742-223947764 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
924342382 1:243049922-243049944 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
1062783929 10:244555-244577 CTGCGAGAGTGGCTGGTGGATGG + Intronic
1064061059 10:12137546-12137568 CTGTGGGAGATACAGGTAGATGG - Intronic
1064111235 10:12540999-12541021 CTGTGTAATTGTCAGGTGGAGGG + Intronic
1064535224 10:16351235-16351257 CTGTCTCGGTGGCAGGTGGAGGG - Intergenic
1066734094 10:38455633-38455655 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1067160201 10:43819220-43819242 CTGTCTGGGGGTCAGGTAGATGG + Intergenic
1069786054 10:70988645-70988667 CTGTGTGCGTCTCAGGCAGAGGG + Intergenic
1069794949 10:71046110-71046132 GTCTGTGAGTGGCAGGGAGACGG + Intergenic
1069861165 10:71472574-71472596 CTGGGTGAATGGCAGGCACATGG + Intronic
1070123539 10:73601453-73601475 GTGTGTGAGTATCAGGTTGAAGG - Intronic
1070726332 10:78793724-78793746 CAGTGAGTGTGGCAGGAAGAAGG - Intergenic
1072564976 10:96609939-96609961 CTGTGAGAGAGGCAGGTGGAGGG - Intronic
1073187752 10:101626897-101626919 CTGTGGGAGTGGCAGGGATGAGG + Intronic
1073477112 10:103761638-103761660 CTGTGTGGGTGGCAGGTGGCTGG - Intronic
1074760518 10:116664068-116664090 CCGTGTGAGTTGCAGGGAGCTGG + Exonic
1074895957 10:117777872-117777894 CTATGTGTGTGACTGGTAGATGG + Intergenic
1075357303 10:121792076-121792098 CTGTTTGAGTGGCTGGGAGAGGG + Intronic
1075445820 10:122512110-122512132 CTGTGGGGGTAGCAGGAAGAGGG + Intronic
1075611468 10:123858140-123858162 CTGTGTGGTTGGCAGATACAGGG - Intronic
1076522947 10:131092247-131092269 CTGTGTGAGTGGCATTTTCATGG + Intergenic
1076969113 11:123456-123478 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
1077032742 11:477015-477037 CTGGGTGGGGGGCAGGGAGAAGG + Intronic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1077475852 11:2790131-2790153 CTGTCTCTGTGGCAGGTTGAGGG - Intronic
1079534927 11:21502646-21502668 CTGTCTGAAAGGCAGGTAGTAGG - Intronic
1079683823 11:23331740-23331762 CAGTGGGACTGGCAGGTAGGTGG + Intergenic
1080216479 11:29847652-29847674 GTGTGTGTGTGGCAGGGATAAGG - Intergenic
1081622603 11:44627855-44627877 CTCTGTGTCTGGCAGGTAGGGGG + Intergenic
1083489013 11:63001132-63001154 CTATGTGAGGGGCAGGGAGGAGG - Intronic
1084033754 11:66495607-66495629 CTGTGAGAGGGGCAGGCAGGTGG - Intronic
1084675265 11:70630327-70630349 CTGTGAGGGTGGCAGACAGAAGG + Intronic
1084805542 11:71576597-71576619 CTGTGGGAATGGCAGGTGGTGGG + Intergenic
1085170443 11:74445236-74445258 CTTGGTCAGTGGCAGGGAGAAGG - Intergenic
1085861668 11:80243084-80243106 ATGTGTGAGTGGCATGATGATGG - Intergenic
1086902874 11:92387399-92387421 CTGTGTGTGTTGCAGGGTGAAGG + Intronic
1086984334 11:93232133-93232155 CTTTGAGACTTGCAGGTAGAGGG + Intergenic
1087235850 11:95717909-95717931 CTGGGTGAATAGAAGGTAGATGG - Intergenic
1087428205 11:98016965-98016987 CTGTGTCAGTGGTAGCTTGATGG - Intergenic
1087644301 11:100789404-100789426 GTGGATGAGTGGCAGGTAGCTGG + Intronic
1088377998 11:109162755-109162777 CTGTGTGAGTTCCATGAAGAAGG + Intergenic
1088896788 11:114084554-114084576 CTGTGTGATTCTCAGGTAGCAGG + Intronic
1089869615 11:121660490-121660512 CTATGTGACTGGAAGGTAGTAGG + Intergenic
1090078071 11:123591886-123591908 CTGTAGCAGTGGCAGGGAGAGGG - Intronic
1090942612 11:131400968-131400990 GTGTGTGTGTGGCAGGTGGCAGG - Intronic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1091897842 12:4119419-4119441 CCGTGGGTGCGGCAGGTAGAAGG + Intergenic
1092040178 12:5377262-5377284 CTGTGAGAGTGGGAGAGAGATGG + Intergenic
1092337804 12:7649213-7649235 TTGTGCTAGTGGCTGGTAGAAGG - Intergenic
1093881928 12:24414588-24414610 CTGGGTGAGAGGCAGGCAGATGG - Intergenic
1094057225 12:26279786-26279808 CTTTGTGAGAGGCAGGTGGTAGG - Intronic
1096467071 12:51852481-51852503 CTGTGTGACTGTAAGGTACATGG - Intergenic
1098486757 12:71030422-71030444 CTGGGTGAGTGACACGTGGAAGG + Intergenic
1099725897 12:86427497-86427519 CTGTGTGTGTGTAAGGTGGATGG - Intronic
1100132383 12:91512240-91512262 GTGTGTGTGTGGCAGGGAGGCGG + Intergenic
1100665838 12:96752144-96752166 CTATGTGAATGGCAGGATGATGG - Intronic
1100723895 12:97388012-97388034 CTGAGTGACAGGCAGCTAGAGGG - Intergenic
1102469170 12:113149910-113149932 CTACGTGAGTGGGACGTAGAGGG + Exonic
1102725754 12:115063109-115063131 GGGTGGGGGTGGCAGGTAGACGG + Intergenic
1103172307 12:118832225-118832247 GTGTGTGGGAGGCAGGAAGAGGG - Intergenic
1104064891 12:125298309-125298331 CTGGGTGGGTGGGAGGGAGATGG - Intronic
1104856455 12:131904569-131904591 CTGGGTGAGTGGCTGGGGGATGG + Intronic
1105662577 13:22514826-22514848 GTGTGTGTGTGGCAGGGAGGAGG + Intergenic
1106621495 13:31374804-31374826 CTGTGTCAGTGGCAGTTAAGAGG + Intergenic
1107598466 13:41988294-41988316 CTGTGGTTATGGCAGGTAGAAGG - Intergenic
1108800068 13:54084095-54084117 CTGTGTGACTGGCAGGTGGTCGG - Intergenic
1109237616 13:59843944-59843966 CTGTATGAGTGGCGGGCAGGAGG + Intronic
1110064416 13:71085875-71085897 CAGTGTGAGTGTGATGTAGATGG + Intergenic
1111227568 13:85294460-85294482 GTGTGTGAGTGGCAGGTAGCTGG + Intergenic
1111710657 13:91808778-91808800 CTATGTGAGTGGCAGGGACTGGG - Intronic
1112490165 13:99855581-99855603 CAGTGTGTGTGGCAGAGAGAGGG + Intronic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1114488080 14:23076247-23076269 CCATGTGATAGGCAGGTAGAAGG + Intronic
1114663772 14:24367124-24367146 TTGTGTGAGAGGGAGTTAGATGG - Exonic
1114682935 14:24502139-24502161 GTGTGTGAGAAGCAGGTTGATGG - Intronic
1117349390 14:54866642-54866664 CTGAGTGAGTCACAGGAAGATGG + Intronic
1118705689 14:68478205-68478227 CTGTGTCAGAGGGAGGTCGATGG + Intronic
1118846416 14:69550830-69550852 CTGTGTGAGTGTGAGGTAGGTGG + Intergenic
1119196011 14:72717068-72717090 CTGTGTAAGTGGGTTGTAGATGG - Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119655093 14:76411602-76411624 CTGTGTGTGTTGCAGGAAGGAGG + Intronic
1120996569 14:90422437-90422459 CAGAGTGTGTGACAGGTAGAGGG - Intergenic
1121695510 14:95908927-95908949 CAGTGGAAGTGGCAGGTAGGCGG + Intergenic
1121991423 14:98561607-98561629 CTGTATGTGTGGAAGGTAGTGGG + Intergenic
1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG + Intergenic
1123029763 14:105446171-105446193 CTGTGTCAGTAGCATGTGGAGGG - Intronic
1202897760 14_GL000194v1_random:19992-20014 CTGTGTGGGTGCCAGGTCCAAGG + Intergenic
1123682552 15:22773147-22773169 CTGTGAAAGTGCCAGGTTGAAGG + Intronic
1123761565 15:23437379-23437401 CGGTGTGAGTGCCAGGCAGACGG - Intergenic
1123762532 15:23443933-23443955 CTGTGAAAGTGCCAGGTTGAAGG + Exonic
1123929916 15:25161766-25161788 CTGTGTTATTGGCAGATGGAAGG + Intergenic
1124334302 15:28845671-28845693 CTGTGAAAGTGCCAGGTTGAAGG + Intergenic
1124493555 15:30173099-30173121 GTGTGTGTGTGGCATGTAGTAGG + Intergenic
1124493564 15:30173189-30173211 GTGTGTGTGTGGCATGTAGTAGG + Intergenic
1124907845 15:33888307-33888329 GTGTGTGTGTGGCAGGGGGAAGG + Intronic
1126578750 15:50222789-50222811 GTGTGTGGGTGGCAGGAAAAAGG + Intronic
1128058777 15:64720145-64720167 CTGTGCCACTGGAAGGTAGAAGG - Intergenic
1128878638 15:71223077-71223099 CAGTGTGTCTGGCAGGTGGAAGG - Intronic
1129065703 15:72902221-72902243 CTGTGTGCATGGCATGGAGAAGG - Intergenic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1129675405 15:77630577-77630599 CTGTGTGACTGGGAGGGAGGTGG - Intronic
1130197591 15:81795273-81795295 CTGTATGAGTGGCAGATCCAGGG - Intergenic
1130198956 15:81807611-81807633 CTGGTGGAGTGGCACGTAGAAGG + Intergenic
1131096250 15:89655762-89655784 CTGTGTGAGTGGCGTGCAGGAGG - Intergenic
1131449444 15:92527295-92527317 CTGGGTGAGTGCCAGGTACATGG + Intergenic
1133153754 16:3857096-3857118 CTCTGAGAGTGGCAGGATGATGG - Intronic
1133248805 16:4466598-4466620 CAGAGTCAGTGGCTGGTAGAAGG - Intronic
1133437094 16:5789089-5789111 CTGTGTGAGAGAGAGGAAGAGGG - Intergenic
1134071137 16:11260456-11260478 GTGTCTCAGTGGCGGGTAGAGGG + Intronic
1134202255 16:12208942-12208964 CTTTGTTAGGGGCTGGTAGAAGG + Intronic
1134815184 16:17199880-17199902 GTATGTGAGAGGCAGGCAGAGGG + Intronic
1136294321 16:29293052-29293074 CAGTGTGAGCCGCAGGGAGAAGG - Intergenic
1139330003 16:66180508-66180530 CTGTGTGAATGGCATGCACATGG - Intergenic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG + Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1141641956 16:85346688-85346710 ATGAGTGATTGACAGGTAGATGG + Intergenic
1142100227 16:88267099-88267121 CAGTGTGAGCCGCAGGGAGAAGG - Intergenic
1142451562 16:90175666-90175688 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1142493448 17:293246-293268 CTGCATGAGTGGCAGGCGGAGGG - Intronic
1145092401 17:19996773-19996795 GTGTGTGAGTGGCAGGATGCAGG - Intergenic
1146925484 17:36742043-36742065 GTGTGTGAGAGGGAGGAAGAGGG + Intergenic
1146954798 17:36931297-36931319 GTGTGTGAGAGGCAGGAAGGTGG - Intergenic
1146986030 17:37219076-37219098 CTGTGTGATTAGAAGGTTGAGGG + Intronic
1147999643 17:44380227-44380249 CTATGTGAGTGGCATGAAGGGGG - Exonic
1148070398 17:44905428-44905450 CTGGTTGAGTTGCAGGTAGCAGG + Intronic
1148210504 17:45805755-45805777 ATGAGTGAGGGGCAGGGAGAGGG - Intronic
1151555567 17:74844841-74844863 CTCCGTGAGTGGCATGTAGATGG - Intronic
1151724355 17:75875845-75875867 CTGTGCGAGAGGCTGGCAGAGGG + Intronic
1152299654 17:79487616-79487638 CTGGGTGAGTGGCATGGAGCTGG + Intronic
1154949122 18:21191039-21191061 CTGTGTGCCTGCCAGGTAGTGGG - Intergenic
1156903028 18:42323334-42323356 CAGTGTGAGAGGCAGGAATAAGG + Intergenic
1157009987 18:43635634-43635656 CAGAGTGAGAGGCAGGTAGGCGG + Intergenic
1157632901 18:49117716-49117738 CAGTGGGTGTGGCAGGTAGCAGG - Intronic
1158839726 18:61372072-61372094 TTGTGTGAGTGAAAAGTAGAAGG - Intronic
1160226031 18:77011585-77011607 CTCTGGGAGTGGCAGGCAGCCGG - Intronic
1160645919 19:193382-193404 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
1161227288 19:3152648-3152670 CTCTGGGATTGGCAGTTAGAGGG + Intronic
1161347731 19:3776547-3776569 ATGTGTGAGTGGATGGTAGGTGG + Intergenic
1161482880 19:4519529-4519551 CTGTCTCAGGGGCAGGTAGGAGG - Intergenic
1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG + Intronic
1162741129 19:12774572-12774594 CTGGGTGATGGGCAGGAAGAGGG - Intronic
1163234009 19:16020645-16020667 CTGTGTGAGTGGTTGGTCCAGGG + Intergenic
1163258645 19:16173260-16173282 CTGTGTGAGTGTGGGGTGGAGGG - Intronic
1163588448 19:18176769-18176791 CTGAGAGAGTGGCAAGGAGAGGG + Intronic
1163704464 19:18804250-18804272 CTGTGTGCGTTGCAGGGAGATGG + Intergenic
1164400654 19:27900035-27900057 ATGTGTGAGTGAGTGGTAGATGG - Intergenic
1165108307 19:33487216-33487238 CTGGGTGAGTGGAAGGCAGGGGG + Intronic
1165262693 19:34634466-34634488 CCGTGTGAGTGCCAGGTAGGTGG - Intronic
1166197724 19:41218020-41218042 CTGTGTGTTTGGCACGTGGAGGG - Intergenic
1167445517 19:49534958-49534980 CTGTGTGTGTGGCAGGGTGTGGG - Intronic
1167663005 19:50807422-50807444 CTGTATGAGAGGGAGATAGATGG + Intergenic
1202714778 1_KI270714v1_random:36186-36208 GTGTGTGAGAGGGAGGGAGAGGG - Intergenic
925351931 2:3207172-3207194 GTGTGTGCCTGTCAGGTAGATGG - Intronic
925774319 2:7319190-7319212 CTGAGGGAGAGGGAGGTAGAAGG - Intergenic
925818015 2:7772171-7772193 CAGTGTGGGTGGCAGGCAAAAGG - Intergenic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
927073598 2:19554554-19554576 CAGTGTGAGTGTCAGGTAGTGGG - Intergenic
927455381 2:23244429-23244451 ATGTGTGTGTGGCATGTATAAGG - Intergenic
927930093 2:27038367-27038389 CTCTGTGGGTGGTAGGTGGAGGG + Intronic
928106106 2:28471566-28471588 CTGTGAGGGTGACAGGAAGAGGG + Intronic
928418846 2:31121835-31121857 AGGTGGGAGTGGGAGGTAGATGG - Intronic
929582876 2:43094514-43094536 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
929583078 2:43096504-43096526 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
929801559 2:45108875-45108897 CTGTGGGAGTGCCACTTAGATGG - Intergenic
930541470 2:52712215-52712237 CTGTGTGAGTGGTAGATGTATGG + Intergenic
931516040 2:63051269-63051291 CTGTGAGAGATCCAGGTAGATGG + Exonic
931694790 2:64863671-64863693 CCGTGTGTGTGGTAGGTTGATGG - Intergenic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
932641226 2:73449237-73449259 CTGTGTGAGTAGAAACTAGATGG - Exonic
932641285 2:73449804-73449826 CTTTGTGAGTAGAAAGTAGACGG - Exonic
932641358 2:73450515-73450537 GTGTGTGAGTAGAAAGTAGAGGG - Exonic
932641388 2:73450800-73450822 GTGTGTGAGTAGAAAGTAGAGGG - Exonic
933089728 2:78105751-78105773 GTGGGTAAGTGGCAGGTAGCTGG + Intergenic
933818376 2:86087487-86087509 TTTTCTGAGTGGCAGATAGAAGG - Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934040680 2:88125508-88125530 CTGTGTGAGTGGTTGGCAGATGG - Intronic
934722891 2:96594108-96594130 CAGTCTGAGTGGCAGCCAGAAGG - Exonic
935206851 2:100903732-100903754 CTGTGGGAGTGGGAGGCTGAAGG - Intronic
935560959 2:104559448-104559470 CTGTGTGAGTGCCGGGTTGTGGG + Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
939932554 2:148253678-148253700 GTGGGTGAGTGGCGGGTAGCTGG + Intronic
939933488 2:148259577-148259599 GTGGGTGAGTGGCAGGTAGCAGG + Intronic
943782186 2:191836953-191836975 CTGTATCAGTGACAGGCAGAGGG + Intronic
945026880 2:205628118-205628140 GTGTGTGACTGGGTGGTAGAGGG + Intergenic
945578185 2:211558372-211558394 CTTTGTAAGTGGGAGGCAGAAGG - Intronic
946195864 2:218032888-218032910 GTGTGACAGTGGCAGGGAGAGGG - Intergenic
946680427 2:222209121-222209143 TTGTTAGAGTGGTAGGTAGAGGG - Intronic
948127993 2:235578904-235578926 CTGTGTGACTGACAGCTAGAGGG - Intronic
948150545 2:235740948-235740970 TTGTGTGTGTGGCAGGTGGCAGG + Exonic
949082945 2:242119972-242119994 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1169198625 20:3696957-3696979 CTGTGTGTGTGGCAGGAGGTGGG - Intronic
1169641523 20:7757562-7757584 CTATGTGAGAGGTGGGTAGAAGG - Intergenic
1170934132 20:20795277-20795299 GTGTGTGAGAAGCAGGTTGAGGG + Intergenic
1171262854 20:23748516-23748538 CTGTGTGCTGGGCAGGGAGAAGG - Intronic
1171271981 20:23824720-23824742 CTGTGTGCTGGGCAGGGAGAAGG - Intronic
1172477370 20:35248956-35248978 CTCAGAGAGTGGCAGGTGGATGG + Intronic
1174077223 20:47946253-47946275 CTGTGGGGGTGGCAGGGAGCAGG + Intergenic
1174719106 20:52792248-52792270 CTGTATGAGTGCCAGGTCCAAGG - Intergenic
1175666877 20:60868752-60868774 CGGTGTGAGTGGGACGTAGAGGG - Intergenic
1176279586 20:64292834-64292856 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1176612161 21:8992875-8992897 GTGTGAGAGTAGCAAGTAGATGG - Intergenic
1176617445 21:9035981-9036003 CTGTGTGGGTGCCAGGTCCAAGG + Intergenic
1176889028 21:14292026-14292048 CTTTGTGAGTAGCAGTTAGGTGG - Intergenic
1177942263 21:27425305-27425327 CTGTGTGTGTGGCAGAAAGGGGG + Intergenic
1178801260 21:35797945-35797967 TTGTGTGTGTGCCAGGTATAGGG - Intronic
1180002081 21:44999738-44999760 CTGTGTTGGTGGCAGGTGGCCGG + Intergenic
1181319083 22:21990926-21990948 CTGAGTGAGTGGCCAGAAGAGGG + Intergenic
1182124181 22:27804392-27804414 GTGTGTGAGTGGCTGAAAGAAGG + Intergenic
1182158608 22:28099495-28099517 GTGGGCGAGTGGCAGGTAGCTGG - Intronic
1182509293 22:30807574-30807596 CTGTGTGAGAGGCAGGGAGCTGG - Intronic
1183703771 22:39464401-39464423 CTCTGTGCCTGGCACGTAGAAGG + Intronic
1184227020 22:43134894-43134916 CTGAGTGACTGGCAGGTATGGGG + Intronic
1184777084 22:46628635-46628657 GTGTCTGAGGGGCAGGTGGAGGG + Intronic
1185227540 22:49661417-49661439 CTGTGTGAGTGGCAGGGCCAAGG - Intergenic
951078700 3:18425803-18425825 GTGTGTGAGTGGGAGGGAGGAGG + Intronic
951966455 3:28391342-28391364 GTGTGTGTGTGGCAGGGAGAGGG - Intronic
952824151 3:37510813-37510835 GTGAGTGAGTGGCAGAAAGAAGG - Intronic
953494177 3:43372266-43372288 GTGCGTGTGTGACAGGTAGAGGG - Intronic
954266219 3:49472169-49472191 CTGGTGGAGTGGCAGGAAGAGGG + Intronic
954640916 3:52097236-52097258 GTGTGTGTGTGGCGGGGAGAGGG + Intronic
955393337 3:58536901-58536923 CTGTGTTAGTAGCAGGGAGATGG - Intronic
956192434 3:66620654-66620676 GTGGATGAGTGGCAGGCAGATGG - Intergenic
956994417 3:74807869-74807891 GTATGTGTGTGGCAGGGAGAAGG + Intergenic
959111637 3:102129799-102129821 CTGTCTGAGATACAGGTAGAAGG - Intronic
959817502 3:110692009-110692031 CTGTGGGAGAGTCAGGTGGAAGG + Intergenic
960294555 3:115927432-115927454 GTGTGTGGGAGGCAGGTAGGAGG - Intronic
963383530 3:144560945-144560967 CTGTGAGAGTTGCAGGTACCAGG + Intergenic
964920257 3:161887426-161887448 GTGTGTGTGTGGCAAGTATATGG - Intergenic
968371762 3:198226144-198226166 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
969158714 4:5236244-5236266 CTGAGTGAGTGCCAGGTGGAAGG - Intronic
969233809 4:5851199-5851221 CTGTGTGAGTGGCATGCAGAAGG - Intronic
969575808 4:8035068-8035090 GTGAGTGGGTGGCAGGTAGGTGG + Intronic
970428366 4:15965618-15965640 CTGTGAAGGTGGCAGGGAGAAGG - Intronic
971250788 4:24971642-24971664 GTGGGTGAGTGGCAGATAGCTGG - Intronic
971305803 4:25480254-25480276 TAGGGTGAGTGCCAGGTAGATGG + Intergenic
971811083 4:31428130-31428152 ATGTGTGAGTGGTGGATAGAAGG + Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
974103861 4:57445643-57445665 CTGTTTGGGTGGCAGGCAGGAGG + Intergenic
976318279 4:83682869-83682891 CTGTTTTAGTGGCAAGAAGAAGG - Intergenic
976788007 4:88844664-88844686 CAGTTGGAGAGGCAGGTAGAGGG + Intronic
977292961 4:95182937-95182959 CTCTGTGTGCGGCAGGTGGAAGG - Exonic
979260448 4:118638622-118638644 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
979264257 4:118683112-118683134 GGGTGTGTGTGGCAGGAAGAGGG - Intergenic
980343750 4:131584581-131584603 GTGGGTGAGTGGCAGGTAGCTGG + Intergenic
981305453 4:143242297-143242319 GTAGGTGAGTGGCAGGTAGCTGG - Intergenic
982759301 4:159261824-159261846 ATAGGTGAGTGGGAGGTAGAAGG - Intronic
984303246 4:177951622-177951644 GTGTGTGAGTGGCAGGTGTTGGG - Intronic
984428556 4:179619534-179619556 CTGAGGGAGAGGCAGGTATAGGG - Intergenic
985726261 5:1517329-1517351 CTGTGTCAGAGGCAGGGACATGG + Intronic
986393162 5:7303683-7303705 CTGTGAAAGTGCCAGGTTGAAGG + Intergenic
986428436 5:7657555-7657577 ATGTGTGCATGGCAGGGAGATGG - Intronic
986443527 5:7801277-7801299 CTGTGTGTCTGGCAGGGCGAGGG - Intronic
986458330 5:7942726-7942748 CTGGGAGAGTGGCAGGAAGTGGG - Intergenic
986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG + Intronic
990580657 5:57164418-57164440 CTGTGTTAGAGGCATGTACAGGG - Intergenic
990796908 5:59553870-59553892 CTCTGTGAGGGGCTGCTAGAGGG - Intronic
991245088 5:64502275-64502297 CTGTCTGACTGCCAAGTAGAAGG - Intergenic
992136185 5:73748762-73748784 CTGTGGGAGTGGCGGGGAAATGG - Intronic
993861804 5:93145399-93145421 CTGTGTCAGTGGGATGTACAAGG - Intergenic
994685974 5:102952865-102952887 ATGTGTGGGTTGGAGGTAGATGG - Intronic
994788176 5:104189430-104189452 GTGGGTGAGTGGCAGGTAGCTGG - Intergenic
994980716 5:106873069-106873091 CTGTGTCCATGGCAGGTAGGAGG + Intergenic
996473555 5:123888181-123888203 CTGTGTGAGTGTCTGGGAGAGGG + Intergenic
998816280 5:146017442-146017464 CTGTGAGTGTGGGAGGCAGAGGG - Intronic
999314298 5:150574265-150574287 CTGGGAGAGTGGCAGGGAGGAGG + Intergenic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999525280 5:152398679-152398701 ATGTGAGTGTGGAAGGTAGAGGG - Intronic
1000042361 5:157494234-157494256 GTGGGTGAGTGGGTGGTAGATGG + Intronic
1000926663 5:167202646-167202668 CTGTGTGACTGGGAGGATGATGG - Intergenic
1001553477 5:172620739-172620761 CTTTGTAAGTGCCAGATAGACGG + Intergenic
1002105702 5:176878577-176878599 CTGTGGGTGTGGCAGGTGGAGGG + Exonic
1002384346 5:178855131-178855153 TTGTGTGTCTGGCAGGGAGAAGG - Intergenic
1002731003 5:181331690-181331712 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1002753532 6:142414-142436 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
1004086375 6:12453474-12453496 CTGAGTGTGAGGCAGGAAGAGGG + Intergenic
1004367018 6:15021243-15021265 GTGTGTGTGTGGCAGGCACATGG - Intergenic
1005611016 6:27525238-27525260 GTGTGTGTGTTGGAGGTAGAGGG + Intergenic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1006808783 6:36806444-36806466 CTCTCTGAGTGGGAGGTGGAGGG - Intronic
1007087234 6:39157306-39157328 CAGGGTGAGTGGCAGGGTGAAGG - Intergenic
1007098811 6:39230607-39230629 GTGTGTGTGTGGCGGGGAGAGGG - Intergenic
1009291004 6:61882252-61882274 TGGTGTGAGTGCCAGATAGAAGG - Intronic
1009712696 6:67346324-67346346 GTGGGTGAGTGGCAGGTAGGTGG - Intergenic
1010717231 6:79243701-79243723 ATGTGTGAGTGGGAGGTGGGAGG + Intergenic
1012366544 6:98447551-98447573 CTGGGTGAGGAGGAGGTAGAAGG - Intergenic
1012373403 6:98532422-98532444 GTGGGCGAGTGGCAGGTAGCTGG - Intergenic
1012416509 6:99019338-99019360 GTGGGCGAGTGGCAGGTAGCTGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014553878 6:122821974-122821996 CTGTGCCAGTGGCAGATAGAGGG + Intergenic
1014645056 6:123962911-123962933 GTGGGTGAGTGGCAGGTGGCTGG - Intronic
1015036937 6:128667431-128667453 CTGTGGTAGTTGAAGGTAGAGGG + Intergenic
1015596996 6:134875348-134875370 GTGGGTGAGTGGCTGGTAGCTGG + Intergenic
1015728886 6:136327725-136327747 TTGTGTTAATGGCAGGCAGAAGG + Intergenic
1017157872 6:151338692-151338714 CTTTGGGAGTGCAAGGTAGACGG - Intronic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017903564 6:158739001-158739023 CTGTGTGAGTGGGAGGGGAAAGG - Intronic
1018379737 6:163247760-163247782 ATGGGACAGTGGCAGGTAGACGG - Intronic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1019064864 6:169288291-169288313 CTTTATGAGAGGCAGGTGGAAGG - Intergenic
1019130913 6:169873843-169873865 GTGTGGGGGTGGGAGGTAGATGG - Intergenic
1019723355 7:2586903-2586925 CTGTGGGAGTGTTAGGCAGAGGG + Intronic
1019944557 7:4316319-4316341 CTGAGTGAGTAGCAGGTGGTGGG - Intergenic
1022489364 7:30804960-30804982 ATGTGTGAGTGGTGGGAAGAGGG + Intronic
1023120393 7:36903082-36903104 CTGTGAGATGGGCAGGTAGACGG - Intronic
1023151777 7:37208193-37208215 CTGTGCTAGTCGCTGGTAGACGG + Intronic
1023861455 7:44219793-44219815 CTGGGTGGGTTGCAGGTGGATGG - Intronic
1024076146 7:45818852-45818874 CTGAGTGACTGGCAGGTTGCCGG + Intergenic
1024647457 7:51382438-51382460 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
1025008208 7:55371917-55371939 GTGTGTGTGTGTCAGGTGGAAGG + Intronic
1025051291 7:55736933-55736955 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
1025128255 7:56362600-56362622 CTGAGTGACTGGCAGGTTGCCGG - Intergenic
1025176637 7:56805481-56805503 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
1025695155 7:63770905-63770927 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1026157783 7:67842270-67842292 ATGTGAGGGTGGAAGGTAGAGGG + Intergenic
1026774128 7:73220714-73220736 CTATGTGAGTAGCTGGTGGAGGG + Intergenic
1026864075 7:73811789-73811811 CTGTGCTAGTGGCAGGTGGAGGG - Intronic
1027014985 7:74774100-74774122 CTATGTGAGTAGCTGGTGGAGGG + Exonic
1027073046 7:75171853-75171875 CTATGTGAGTAGCTGGTGGAGGG - Intergenic
1027233438 7:76284662-76284684 CTGAGTGGGTGCCAGGTGGAAGG - Intronic
1028445509 7:90917762-90917784 CTGTGAGAATGCCAGGCAGATGG + Intronic
1028899554 7:96081652-96081674 CTCTGTGAGTGCCTGGTGGATGG + Intronic
1029165896 7:98590256-98590278 TTGTGTGAATGGCAGACAGAAGG - Intergenic
1030655453 7:112162540-112162562 GTGTGTGGGTGGCAGGGAGAGGG - Intronic
1031915970 7:127563558-127563580 CAGTGTGATTGGCAGGGAGTTGG + Intergenic
1032052679 7:128658615-128658637 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1032197409 7:129797412-129797434 CTCTGAGATTGGGAGGTAGAGGG - Intergenic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033118140 7:138644592-138644614 CTGTCTGAGAGGCAGGGCGATGG - Intronic
1033286752 7:140048044-140048066 CTCTCTGTGTGGCAGGTGGACGG + Intronic
1033773746 7:144583087-144583109 ATGGGTGAGTGGCAGGTATTAGG + Intronic
1035769209 8:2133459-2133481 CTCTGTCGGAGGCAGGTAGATGG - Intronic
1035909207 8:3547113-3547135 CTGTGTGAATGGCAGCATGAGGG - Intronic
1036796868 8:11762522-11762544 CTGTGTCAGAGGGAGGGAGAGGG - Exonic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1039122444 8:34162503-34162525 CTGCATGAGTGGCAGATGGAAGG + Intergenic
1039868981 8:41529434-41529456 CTGTGTGGGTGGCACTGAGAGGG + Intronic
1039987697 8:42461816-42461838 TTGGATGAGTGGCAGATAGAGGG - Intronic
1040969439 8:53117821-53117843 GTGTGTGTGTGGTAGGGAGAAGG + Intergenic
1041255436 8:55976477-55976499 CTGTGTGAGTGAAAGGGAGCGGG - Intronic
1041351019 8:56947653-56947675 GTGTGTGTGTTGCAGGGAGAGGG - Intergenic
1041703222 8:60815445-60815467 CTGTTTGAGGGGCAGGGAGAGGG + Intronic
1042077335 8:65010455-65010477 GTGTGTGGGTGGCAGGGAGTAGG - Intergenic
1042154484 8:65827933-65827955 CTGTGTGCCTGGCACATAGAAGG - Intronic
1045426007 8:102066451-102066473 CTGTGTGAGTGGCACGGTGCTGG + Intronic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1047413344 8:124642433-124642455 GTGGGTGATTGGCAGGAAGATGG - Intronic
1047983244 8:130205174-130205196 CTATGTGAGAGGAAGGAAGAAGG - Intronic
1048317009 8:133369992-133370014 CAGTGTGAGGGGCAGGCAGAGGG - Intergenic
1048490403 8:134886698-134886720 GTGTGTGAATGGAAGGTACATGG - Intergenic
1048889456 8:138934755-138934777 ATTTGTGACTGCCAGGTAGAGGG + Intergenic
1049234876 8:141507487-141507509 CTGTGTGGGTGGCAGGTCCCGGG + Intergenic
1049532641 8:143162137-143162159 CTGTGTGGGTGCCAAGTGGAGGG - Intergenic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1049718819 8:144106238-144106260 CTGGGTGAGGGTCAGGTGGAGGG + Exonic
1050027799 9:1353923-1353945 GTTTGAGAGGGGCAGGTAGAGGG + Intergenic
1050212330 9:3274761-3274783 CTGGGTGACTGGGAGTTAGAGGG - Intronic
1050377725 9:4990376-4990398 CAGTGTTAGTAGCTGGTAGAGGG + Intronic
1051125699 9:13802770-13802792 GTGTGTTAATGGCAGGTAGGTGG - Intergenic
1051877374 9:21806517-21806539 CAGAGTGGGTGGCAGGTTGAGGG + Intronic
1052078249 9:24171938-24171960 GTGTGTGTGTGGCAGGGGGAGGG + Intergenic
1052203069 9:25805889-25805911 ATGTGTGAGTGACGGGTTGAGGG + Intergenic
1052203696 9:25812598-25812620 CTGTGGGAGTGACAGCAAGAAGG - Intergenic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1053313184 9:37032321-37032343 ATGTGTGAGTGTCATGGAGAGGG - Intronic
1053729442 9:41037971-41037993 CTGTATGAGGGGTAGGAAGAAGG - Intergenic
1054337870 9:63823833-63823855 CTGTGTGTGTAGTAGGTACACGG - Intergenic
1054349880 9:64012060-64012082 CTGTGTGGGTGCCAGGTCCAAGG + Intergenic
1054699067 9:68394095-68394117 CTGTATGAGGGGTAGGAAGAAGG + Intronic
1054852592 9:69864000-69864022 CTGTGTGAGAAGCAGGTCCATGG + Intronic
1055010223 9:71557571-71557593 CTATGTGAGAGGCAGGGAGGAGG - Intergenic
1056964114 9:91152002-91152024 CTGTGTGGGAGGCAGGGAGTGGG - Intergenic
1057747905 9:97766423-97766445 CTCTGTGAGTTGGAGGTGGAGGG + Intergenic
1059023694 9:110602442-110602464 CTGTGTGGGTGAGGGGTAGAAGG - Intergenic
1059736264 9:117102943-117102965 CTGTGAGAGAGACAGGGAGAGGG + Intronic
1059815959 9:117915398-117915420 ATGTGTGTGTGGTAGGTAGAGGG + Intergenic
1060508894 9:124218068-124218090 TTGTGGGAGTGGCGGGTAGCAGG - Intergenic
1061001356 9:127904710-127904732 CTGTGAGAGTGGCGGGCAGGTGG + Intronic
1061505983 9:131032161-131032183 CTCTGTGGGCGGCAGGTAGGAGG + Exonic
1062214160 9:135380041-135380063 CTGTGTCAGTGCCAGGTGGCAGG + Intergenic
1062755408 9:138284197-138284219 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1202784659 9_KI270718v1_random:37432-37454 CTGTGTGTGTAGTAGGTACATGG + Intergenic
1203579322 Un_KI270745v1:28369-28391 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1185689207 X:2139442-2139464 ATGGGTGAATGGCAGGTGGATGG - Intergenic
1186148406 X:6648607-6648629 TTGTGTGTGTGGCAGGGGGATGG + Intergenic
1186432849 X:9519768-9519790 CTGGGAGAGTGGCAAGGAGAGGG + Intronic
1187273253 X:17797766-17797788 CTGGATGAGGGGCAGGCAGAGGG + Intergenic
1189444382 X:41067148-41067170 CTGTGGGAGTGGCAGCTTGCAGG + Intergenic
1189499184 X:41539111-41539133 CTGTGTGTGTGGGAGTTAGAGGG + Intronic
1190266638 X:48831060-48831082 CTGTGTGAGTGGCAGTTTCTAGG - Intergenic
1191190556 X:57662167-57662189 TTGAGTGAGTGGCAGACAGAGGG + Intergenic
1192319984 X:70082975-70082997 AAGTGAGAGTGGCAGGGAGATGG + Intergenic
1192800128 X:74457762-74457784 GTGTGGGAATGGCAAGTAGATGG - Intronic
1192928609 X:75781928-75781950 CTGGGGGAGCGGCAGGGAGAAGG - Intergenic
1195959162 X:110367672-110367694 CTGTGGGAGAAGCAGGTATAAGG - Intronic
1196025134 X:111034027-111034049 TTGTGTGTATGGCAGGGAGAGGG - Intronic
1196283950 X:113857910-113857932 CTGTTGGAGTGGCAGGGGGAGGG - Intergenic
1196708424 X:118737802-118737824 GTGTGGGAGTGGGAGGTAGGTGG + Intronic
1196744408 X:119056558-119056580 CTTTGTTAGAGGCAGGCAGATGG + Intergenic
1197130533 X:123000780-123000802 CAGTGTGAGAGACAGGTAGTTGG - Intergenic
1197225175 X:123949786-123949808 CTGTGTGGCTGGCTGGCAGAAGG + Intergenic
1198801716 X:140454280-140454302 CTTAGTGAGGGGCAGGTAAAAGG + Intergenic
1200212984 X:154355135-154355157 CTGTGTGGGCGGCAGGCGGACGG - Intronic
1201150841 Y:11094818-11094840 CTGTGTGGGTGCCAGGTCCAGGG + Intergenic
1202381928 Y:24280991-24281013 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1202488856 Y:25389134-25389156 CTGAGTGACTGGCAGGTTGCTGG - Intergenic