ID: 1049680840

View in Genome Browser
Species Human (GRCh38)
Location 8:143917370-143917392
Sequence CGTGGACCCCGAGACGGGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 61}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049680840_1049680847 5 Left 1049680840 8:143917370-143917392 CCTTGCCCGTCTCGGGGTCCACG 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1049680847 8:143917398-143917420 CACTCGGCGCTTGCGCACGGAGG 0: 1
1: 0
2: 0
3: 2
4: 33
1049680840_1049680848 11 Left 1049680840 8:143917370-143917392 CCTTGCCCGTCTCGGGGTCCACG 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1049680848 8:143917404-143917426 GCGCTTGCGCACGGAGGACTTGG 0: 1
1: 0
2: 0
3: 1
4: 45
1049680840_1049680849 14 Left 1049680840 8:143917370-143917392 CCTTGCCCGTCTCGGGGTCCACG 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1049680849 8:143917407-143917429 CTTGCGCACGGAGGACTTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 82
1049680840_1049680845 2 Left 1049680840 8:143917370-143917392 CCTTGCCCGTCTCGGGGTCCACG 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1049680845 8:143917395-143917417 GACCACTCGGCGCTTGCGCACGG 0: 1
1: 0
2: 0
3: 1
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049680840 Original CRISPR CGTGGACCCCGAGACGGGCA AGG (reversed) Exonic
900997804 1:6131810-6131832 CGGGGACCCCGCCACAGGCAGGG + Intronic
901007718 1:6179886-6179908 CGGGGGCGCCGAGACGGGCCGGG - Intronic
902359552 1:15934981-15935003 CGTGGACACCGAGAGGTGAATGG - Exonic
904213627 1:28902504-28902526 CATGGACCCCGAGCTGGGAAGGG - Intronic
905890040 1:41513157-41513179 CGTGGACCCAGGAAGGGGCATGG - Exonic
906961627 1:50422689-50422711 CTGGGACCCCAAGACGGGGAGGG - Intronic
1069807265 10:71133828-71133850 CGTGTACCCTGGGAAGGGCAGGG + Intergenic
1072641007 10:97211350-97211372 AGTGGGCGCCGAGGCGGGCAGGG - Intronic
1075753334 10:124791657-124791679 CCTGGGCCCCGAGAAGGGGACGG - Intronic
1077329792 11:1979225-1979247 CCTGGACCCAGAGACAGGCGTGG + Intronic
1080387317 11:31817766-31817788 CGCGGGCCCCGAGCCGGGCCGGG + Intronic
1081809658 11:45907742-45907764 CGTAGACCCTGAGACAGGCAGGG - Intergenic
1083448638 11:62727533-62727555 AGTGGAGTCCAAGACGGGCAAGG + Intergenic
1083678325 11:64340248-64340270 CGGGCACCCCGACCCGGGCATGG + Exonic
1202812770 11_KI270721v1_random:34404-34426 CCTGGACCCAGAGACAGGCGTGG + Intergenic
1097193854 12:57233216-57233238 TGTGGACCCCAAGACTGGCCGGG + Exonic
1099178761 12:79454060-79454082 CATGGAGCCCGAGACTGGAAAGG + Intergenic
1100329363 12:93570432-93570454 CGTGGGCACCGGGACGAGCACGG + Intronic
1103119895 12:118372186-118372208 TGGGGACCCCGAGAGGGGCTGGG - Intronic
1115754540 14:36518802-36518824 CTTGGACCCCCAGCCGAGCAGGG + Intronic
1127868135 15:63048325-63048347 CGTGGATCCCGGGACTGGCTGGG - Intronic
1129111202 15:73338337-73338359 CCTGGACCGCCTGACGGGCAAGG - Intronic
1132258461 15:100399904-100399926 CGTGGAGCAGGAGACAGGCAAGG + Intergenic
1142156460 16:88534701-88534723 CGTGGCCCCCGGGACGGCCTCGG + Exonic
1143443199 17:6991701-6991723 AGTGGAGCCTGGGACGGGCACGG + Intronic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1151745183 17:76008119-76008141 CCTGGAACCCGAGACGGGGAAGG - Exonic
1152598678 17:81250615-81250637 CGTGGACCCCGCATGGGGCAGGG + Intronic
1152675526 17:81638587-81638609 CGCGGATCCCCAGCCGGGCACGG - Intronic
1161316380 19:3619465-3619487 CGTGGACCCGGAGGTGGGCCAGG + Intronic
1163521533 19:17794891-17794913 CGTGAGCCCCGAGAGGGGCGAGG + Intronic
1163720601 19:18896432-18896454 CGTGCCCCCCGTCACGGGCACGG - Intronic
1167369667 19:49072868-49072890 AGGGGACCCCGGGACGGGAAAGG - Exonic
1167613492 19:50518326-50518348 CGTGGACCCCGTGGCGGCCGGGG - Exonic
1168316487 19:55486818-55486840 CGGGGACCACGAGCCGGGCCCGG - Exonic
927147867 2:20178798-20178820 CCAGGACCCCCAGACAGGCAGGG - Intergenic
938694672 2:133824490-133824512 CCTGGACCCCGAGAACAGCACGG + Intergenic
946712389 2:222519669-222519691 TGTGGACCACTAGACGGGGAGGG - Intronic
948913514 2:241018477-241018499 CTTAGACCCCGGGACGTGCAGGG - Intronic
1173288397 20:41693144-41693166 AGGGGACCCCGAGGCGGGCCTGG - Intergenic
1173852427 20:46227502-46227524 CGTGGACCCCAAGACCGGTGAGG - Exonic
1174180685 20:48672507-48672529 CCTGTACTCCGAGCCGGGCAGGG + Intronic
1180560181 22:16609577-16609599 CGCGGACCCCGACACGCGCCCGG - Intergenic
1180786815 22:18552283-18552305 CTGGTACCCCGAGACTGGCAAGG + Intergenic
1181234923 22:21443025-21443047 CTGGTACCCCGAGACTGGCAAGG - Intronic
1184019089 22:41808572-41808594 CGAGGTCCCAGAGACGGGCGGGG + Intronic
1184649523 22:45913213-45913235 CTTGGCCCCCAAGGCGGGCAGGG + Intergenic
1185061663 22:48610183-48610205 CGTGGCCCCCGAGAAGGGCCTGG + Intronic
950454026 3:13082072-13082094 AGTGGCCCCCGAGTCGCGCAGGG + Intergenic
956557797 3:70541463-70541485 GGTGGACCCAGAGAAGAGCAGGG + Intergenic
961392187 3:126558725-126558747 TGTGGCCCCCGAGGCTGGCAGGG + Exonic
968652635 4:1766299-1766321 TGTGGGCCCTGAGAGGGGCAGGG - Intergenic
969302011 4:6302616-6302638 CGTGGACCCCGACAAAGGGAAGG + Exonic
986714592 5:10513821-10513843 CTTGGACCCTGAGACTGGCATGG + Intronic
997870014 5:137498650-137498672 CGGGGACCCCGCGGCGGGCACGG + Intronic
998142685 5:139709195-139709217 CCTGGAATCCCAGACGGGCAGGG + Intergenic
1003714546 6:8631952-8631974 CCTGGACCCAGAAACTGGCATGG - Intergenic
1015842291 6:137488718-137488740 CGGGGACCCCGAGACAGTCCGGG + Intergenic
1034441166 7:151086708-151086730 CGTGGGGCCCGAGGCGGGCCCGG - Intronic
1035066413 7:156108433-156108455 CGTGGACCCCGGGGCGGGGATGG - Intergenic
1038552349 8:28481052-28481074 CGGGGGCCCCGAGCCGGGCCTGG + Intronic
1038579794 8:28738048-28738070 CGTGGGGCCCGGGACAGGCATGG - Intronic
1040416139 8:47197669-47197691 CCTGGACCCTGAGCTGGGCATGG + Intergenic
1047959303 8:129999321-129999343 CAGGGATCCCGAGACGGGCCTGG - Intronic
1049286188 8:141776572-141776594 CGTTGGCCCCGAGCCAGGCACGG + Intergenic
1049680840 8:143917370-143917392 CGTGGACCCCGAGACGGGCAAGG - Exonic
1060990011 9:127843189-127843211 TGTGGGCCCCGAGAGGGGCGAGG - Exonic
1061574078 9:131495332-131495354 CGGGGGCTCCGAGACGTGCAGGG + Intronic
1062637589 9:137499706-137499728 TGGGGACCCCGAGCCGGGCAAGG - Intronic
1200117542 X:153775952-153775974 CGTGGACGCCGTGACAGGCAAGG + Exonic