ID: 1049685202

View in Genome Browser
Species Human (GRCh38)
Location 8:143936640-143936662
Sequence GACTCACCCGCTGCTTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049685202_1049685208 18 Left 1049685202 8:143936640-143936662 CCAGGACAAGCAGCGGGTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1049685208 8:143936681-143936703 GCCTCCCCAGGGCAGGCACCGGG No data
1049685202_1049685204 6 Left 1049685202 8:143936640-143936662 CCAGGACAAGCAGCGGGTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1049685204 8:143936669-143936691 TGCTGCGCAGAAGCCTCCCCAGG No data
1049685202_1049685205 7 Left 1049685202 8:143936640-143936662 CCAGGACAAGCAGCGGGTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1049685205 8:143936670-143936692 GCTGCGCAGAAGCCTCCCCAGGG No data
1049685202_1049685210 19 Left 1049685202 8:143936640-143936662 CCAGGACAAGCAGCGGGTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1049685210 8:143936682-143936704 CCTCCCCAGGGCAGGCACCGGGG No data
1049685202_1049685206 11 Left 1049685202 8:143936640-143936662 CCAGGACAAGCAGCGGGTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1049685206 8:143936674-143936696 CGCAGAAGCCTCCCCAGGGCAGG No data
1049685202_1049685207 17 Left 1049685202 8:143936640-143936662 CCAGGACAAGCAGCGGGTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1049685207 8:143936680-143936702 AGCCTCCCCAGGGCAGGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049685202 Original CRISPR GACTCACCCGCTGCTTGTCC TGG (reversed) Intronic
901777439 1:11569976-11569998 GACTCAGCCCCATCTTGTCCTGG + Intergenic
903268761 1:22174710-22174732 GACCCAAGCGCTCCTTGTCCTGG + Intergenic
903626037 1:24730758-24730780 AACCGACCCGCTGCTTTTCCGGG + Intergenic
905346726 1:37316244-37316266 AACTCAACGGCTGCTTGGCCCGG + Intergenic
911084108 1:93962251-93962273 GAGACACCAGCTCCTTGTCCGGG - Intergenic
917863228 1:179168673-179168695 GACTCACCACCTGCTTGTACAGG + Intronic
920052301 1:203171512-203171534 TGCTCACCCGCTGGCTGTCCAGG + Exonic
922730383 1:227946336-227946358 GACACACCCTGGGCTTGTCCAGG - Intronic
1070191096 10:74112648-74112670 GCCTCACTGACTGCTTGTCCAGG + Intronic
1073011222 10:100361210-100361232 GACTGACCAGCTGCTTGCCTGGG - Exonic
1073783458 10:106864316-106864338 CACTCACCCGCTGCTTCCCTGGG - Intronic
1075801049 10:125153388-125153410 GGCTTATCCGCTGCTTGTTCAGG - Intronic
1081578645 11:44335783-44335805 GATTCACCCGCTGCCTGTTTCGG - Intergenic
1083651817 11:64208563-64208585 GTCTCACCCGCTGCTGCTCCAGG - Intronic
1088754250 11:112872591-112872613 GCCTCACCAGCTGATGGTCCTGG + Intergenic
1091684142 12:2549759-2549781 GACACATCTGCTGGTTGTCCAGG - Intronic
1096839181 12:54370309-54370331 CACTCACCCTCTGCTTCACCCGG - Exonic
1103469434 12:121168298-121168320 GAGTCACACTCTGCTTGCCCAGG + Intronic
1108695696 13:52900614-52900636 GACTCAGCCTCTGCCTCTCCTGG - Intergenic
1109277898 13:60322584-60322606 GACTCTCCAGATGCTTGTCAAGG - Intergenic
1113761698 13:112852578-112852600 CACTCACCTGCTGTCTGTCCAGG + Intronic
1119543472 14:75455754-75455776 GACTCCACTGCTGCTGGTCCCGG + Intronic
1122600057 14:102916800-102916822 GACTCACCACCTCCTTGACCAGG - Intergenic
1125329251 15:38565529-38565551 GGCCCATCCGCTGCTTGTCCAGG + Intronic
1125972627 15:43924198-43924220 GACTTACCCGCTGCTTATCTGGG + Exonic
1128717332 15:69918232-69918254 GGCCCAACCGCTTCTTGTCCTGG + Intergenic
1133224616 16:4334944-4334966 GACACACCAGCTGCTTGGGCAGG - Exonic
1133274125 16:4626281-4626303 GGCTGACCCGCTGCTGGGCCTGG - Intronic
1141719879 16:85750384-85750406 GACGCACGCGCTCCTTCTCCTGG - Intronic
1141885376 16:86888232-86888254 GACTCCCCAGCTCCTTGTCTTGG + Intergenic
1144585564 17:16485620-16485642 CACACACACACTGCTTGTCCTGG - Intronic
1145184955 17:20786004-20786026 GACTGACCAGCTGCTTGCCTGGG - Intergenic
1150790009 17:68196095-68196117 GTCTCCCCCGCAGCTTCTCCTGG - Intergenic
1151785004 17:76271171-76271193 GCCCCTCCCGCTGCGTGTCCAGG + Exonic
1160778603 19:867994-868016 TTCCCAGCCGCTGCTTGTCCAGG + Exonic
1161585117 19:5101753-5101775 GCCTCACTCGGTGCTTTTCCCGG + Intronic
1161888929 19:7019602-7019624 GACTCACCAGCTGCATCTTCCGG - Intergenic
1161890439 19:7032419-7032441 GACTCACCAGCTGCATCTTCCGG + Exonic
1161891009 19:7038314-7038336 GACTCACCAGCTGCATCTTCCGG - Exonic
1161892525 19:7051147-7051169 GACTCACCAGCTGCATCTTCCGG + Exonic
1161893094 19:7056775-7056797 GACTCACCAGCTGCATCTTCCGG - Exonic
1162752611 19:12838285-12838307 GGCTCACCTGCTGCTTTTCCGGG - Intronic
1165832675 19:38737077-38737099 GCCTCCCCCGCTCCTTGGCCCGG + Intronic
1167472609 19:49684054-49684076 GCCTCACCAGCCACTTGTCCCGG - Exonic
1168318548 19:55494768-55494790 GACTCACCGGCTTCCGGTCCAGG - Exonic
926700154 2:15798118-15798140 CACTCACCCTCTGCCTGGCCTGG - Intergenic
930682403 2:54271174-54271196 GACTGATCCCCTCCTTGTCCGGG + Intronic
931920104 2:67005851-67005873 GAGTCACCTCCTGCTTCTCCTGG + Intergenic
941308247 2:163897571-163897593 CACTCACCCTCTCCTTGTACTGG - Intergenic
945011248 2:205466133-205466155 GACACTCACGCTGCTGGTCCAGG + Intronic
946966431 2:225042245-225042267 CACTCACCCGCTGCTGCTGCCGG + Exonic
947952849 2:234162888-234162910 AACTCACCTAATGCTTGTCCTGG - Intergenic
948372572 2:237498949-237498971 TCCTGACCCTCTGCTTGTCCTGG + Intronic
1169340501 20:4792820-4792842 GCCCCACCCACTGCTTGACCTGG - Intronic
1171426452 20:25051582-25051604 GATGCAGCCGCTGCTGGTCCTGG + Intronic
1174506477 20:51020937-51020959 GACTTTCCCGAAGCTTGTCCTGG - Intronic
1175153024 20:56949926-56949948 GAATCACACACTGCTTGACCTGG - Intergenic
1181669624 22:24420116-24420138 TGCTCACTGGCTGCTTGTCCTGG + Intronic
1182516168 22:30860362-30860384 GACCCACCTGCTTCTTGTCAAGG - Intronic
1184011975 22:41755872-41755894 TCCTCACCCTCTGCTTGCCCAGG + Intronic
1185280420 22:49967470-49967492 CCCTCAGCCGCTGCCTGTCCAGG + Intergenic
950922228 3:16705991-16706013 GCCTCACCCACTGCTAGTTCTGG + Intergenic
951890021 3:27559825-27559847 CACTCACCAGCTGCGTGACCTGG - Intergenic
953002486 3:38948534-38948556 CACTCACTGGCTGCTTGACCTGG + Intronic
960988293 3:123294697-123294719 GACTGTCCCGATGCTGGTCCAGG - Intronic
961381492 3:126498890-126498912 CCCTCATCCCCTGCTTGTCCTGG + Intronic
968490824 4:889750-889772 GACCCAGCCGCTGCCTGTCAGGG + Intronic
971505288 4:27359647-27359669 GACTCACCTTCTGCTTTCCCAGG - Intergenic
979776149 4:124590598-124590620 GCCTCACCTGCTCCTTTTCCAGG + Intergenic
986413348 5:7503938-7503960 GACACACCCGCTCACTGTCCTGG + Intronic
987847493 5:23305167-23305189 GACGGACCCGCTGCTTGCTCAGG + Intergenic
999617657 5:153441930-153441952 AGCTCACCCTCTGCATGTCCAGG - Intergenic
1000656400 5:163884356-163884378 CACTCACCTGCTGTGTGTCCAGG + Intergenic
1001617639 5:173056246-173056268 GACTCAGCCCCTGATTGGCCGGG + Intergenic
1002056071 5:176598504-176598526 GACACACGCTCTGCCTGTCCAGG + Exonic
1006111689 6:31750569-31750591 GACTCACGCCCTGCTCGTACTGG - Intronic
1007235079 6:40384982-40385004 CCCTCAACCCCTGCTTGTCCAGG + Intergenic
1017278839 6:152601935-152601957 TACCCACATGCTGCTTGTCCTGG + Intronic
1019577761 7:1745777-1745799 GCCTCACCATCTGCTTGCCCCGG + Exonic
1029445931 7:100612809-100612831 GACCCACCAGCTCCTGGTCCTGG - Exonic
1032312775 7:130803636-130803658 GCCTCACCCCCAGCCTGTCCAGG - Intergenic
1034383642 7:150720382-150720404 GCCTCACCGCCTGCTGGTCCTGG - Exonic
1038174719 8:25170046-25170068 CACTCACCAGCTCCCTGTCCTGG + Intergenic
1043528505 8:81123202-81123224 GAGTCAGCTGCTGCTTTTCCTGG - Intergenic
1047314011 8:123715771-123715793 CACTCAACCGCTGCCTGGCCAGG - Intronic
1049685202 8:143936640-143936662 GACTCACCCGCTGCTTGTCCTGG - Intronic
1056791784 9:89630443-89630465 GTCTCACCCTGTGTTTGTCCTGG - Intergenic
1061177455 9:129006326-129006348 GCTTCATCCGCTGTTTGTCCCGG - Exonic
1061881124 9:133569563-133569585 CACTCACCCGCTCCCAGTCCTGG - Exonic
1192274680 X:69616689-69616711 GACTCACCTGGTGCCCGTCCTGG - Exonic
1197150248 X:123212951-123212973 GGCTCACCTGCTGTGTGTCCTGG - Intronic