ID: 1049688548

View in Genome Browser
Species Human (GRCh38)
Location 8:143949013-143949035
Sequence GCCGCAGAGAGAGCCAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049688542_1049688548 -5 Left 1049688542 8:143948995-143949017 CCACTAAACCTGTCCAAAGCCGC 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1049688548 8:143949013-143949035 GCCGCAGAGAGAGCCAGGAGGGG No data
1049688540_1049688548 19 Left 1049688540 8:143948971-143948993 CCATTTAGAGAGGAGCTGGAGAG 0: 1
1: 0
2: 1
3: 18
4: 198
Right 1049688548 8:143949013-143949035 GCCGCAGAGAGAGCCAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049688548 Original CRISPR GCCGCAGAGAGAGCCAGGAG GGG Intronic
No off target data available for this crispr