ID: 1049693250

View in Genome Browser
Species Human (GRCh38)
Location 8:143971924-143971946
Sequence ACAGATCCCTGGAGGTTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049693250_1049693259 20 Left 1049693250 8:143971924-143971946 CCCAGCAACCTCCAGGGATCTGT No data
Right 1049693259 8:143971967-143971989 TCAGAAGTAGTTCCCACCCCAGG No data
1049693250_1049693260 23 Left 1049693250 8:143971924-143971946 CCCAGCAACCTCCAGGGATCTGT No data
Right 1049693260 8:143971970-143971992 GAAGTAGTTCCCACCCCAGGAGG No data
1049693250_1049693255 -8 Left 1049693250 8:143971924-143971946 CCCAGCAACCTCCAGGGATCTGT No data
Right 1049693255 8:143971939-143971961 GGATCTGTCTGGCTCACCCCTGG No data
1049693250_1049693261 29 Left 1049693250 8:143971924-143971946 CCCAGCAACCTCCAGGGATCTGT No data
Right 1049693261 8:143971976-143971998 GTTCCCACCCCAGGAGGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049693250 Original CRISPR ACAGATCCCTGGAGGTTGCT GGG (reversed) Intronic