ID: 1049693254

View in Genome Browser
Species Human (GRCh38)
Location 8:143971935-143971957
Sequence GGGTGAGCCAGACAGATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049693254_1049693261 18 Left 1049693254 8:143971935-143971957 CCAGGGATCTGTCTGGCTCACCC No data
Right 1049693261 8:143971976-143971998 GTTCCCACCCCAGGAGGTAGAGG No data
1049693254_1049693260 12 Left 1049693254 8:143971935-143971957 CCAGGGATCTGTCTGGCTCACCC No data
Right 1049693260 8:143971970-143971992 GAAGTAGTTCCCACCCCAGGAGG No data
1049693254_1049693259 9 Left 1049693254 8:143971935-143971957 CCAGGGATCTGTCTGGCTCACCC No data
Right 1049693259 8:143971967-143971989 TCAGAAGTAGTTCCCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049693254 Original CRISPR GGGTGAGCCAGACAGATCCC TGG (reversed) Intronic