ID: 1049693258

View in Genome Browser
Species Human (GRCh38)
Location 8:143971957-143971979
Sequence GAACTACTTCTGATTCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049693258_1049693268 11 Left 1049693258 8:143971957-143971979 CCTGGATGAATCAGAAGTAGTTC No data
Right 1049693268 8:143971991-143972013 GGTAGAGGAAAGACAGCCCTGGG No data
1049693258_1049693269 12 Left 1049693258 8:143971957-143971979 CCTGGATGAATCAGAAGTAGTTC No data
Right 1049693269 8:143971992-143972014 GTAGAGGAAAGACAGCCCTGGGG No data
1049693258_1049693267 10 Left 1049693258 8:143971957-143971979 CCTGGATGAATCAGAAGTAGTTC No data
Right 1049693267 8:143971990-143972012 AGGTAGAGGAAAGACAGCCCTGG No data
1049693258_1049693261 -4 Left 1049693258 8:143971957-143971979 CCTGGATGAATCAGAAGTAGTTC No data
Right 1049693261 8:143971976-143971998 GTTCCCACCCCAGGAGGTAGAGG No data
1049693258_1049693260 -10 Left 1049693258 8:143971957-143971979 CCTGGATGAATCAGAAGTAGTTC No data
Right 1049693260 8:143971970-143971992 GAAGTAGTTCCCACCCCAGGAGG No data
1049693258_1049693270 17 Left 1049693258 8:143971957-143971979 CCTGGATGAATCAGAAGTAGTTC No data
Right 1049693270 8:143971997-143972019 GGAAAGACAGCCCTGGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049693258 Original CRISPR GAACTACTTCTGATTCATCC AGG (reversed) Intronic