ID: 1049693259

View in Genome Browser
Species Human (GRCh38)
Location 8:143971967-143971989
Sequence TCAGAAGTAGTTCCCACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049693250_1049693259 20 Left 1049693250 8:143971924-143971946 CCCAGCAACCTCCAGGGATCTGT No data
Right 1049693259 8:143971967-143971989 TCAGAAGTAGTTCCCACCCCAGG No data
1049693254_1049693259 9 Left 1049693254 8:143971935-143971957 CCAGGGATCTGTCTGGCTCACCC No data
Right 1049693259 8:143971967-143971989 TCAGAAGTAGTTCCCACCCCAGG No data
1049693253_1049693259 12 Left 1049693253 8:143971932-143971954 CCTCCAGGGATCTGTCTGGCTCA No data
Right 1049693259 8:143971967-143971989 TCAGAAGTAGTTCCCACCCCAGG No data
1049693251_1049693259 19 Left 1049693251 8:143971925-143971947 CCAGCAACCTCCAGGGATCTGTC No data
Right 1049693259 8:143971967-143971989 TCAGAAGTAGTTCCCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049693259 Original CRISPR TCAGAAGTAGTTCCCACCCC AGG Intronic