ID: 1049693260

View in Genome Browser
Species Human (GRCh38)
Location 8:143971970-143971992
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049693257_1049693260 -9 Left 1049693257 8:143971956-143971978 CCCTGGATGAATCAGAAGTAGTT No data
Right 1049693260 8:143971970-143971992 GAAGTAGTTCCCACCCCAGGAGG No data
1049693258_1049693260 -10 Left 1049693258 8:143971957-143971979 CCTGGATGAATCAGAAGTAGTTC No data
Right 1049693260 8:143971970-143971992 GAAGTAGTTCCCACCCCAGGAGG No data
1049693251_1049693260 22 Left 1049693251 8:143971925-143971947 CCAGCAACCTCCAGGGATCTGTC No data
Right 1049693260 8:143971970-143971992 GAAGTAGTTCCCACCCCAGGAGG No data
1049693256_1049693260 -8 Left 1049693256 8:143971955-143971977 CCCCTGGATGAATCAGAAGTAGT No data
Right 1049693260 8:143971970-143971992 GAAGTAGTTCCCACCCCAGGAGG No data
1049693254_1049693260 12 Left 1049693254 8:143971935-143971957 CCAGGGATCTGTCTGGCTCACCC No data
Right 1049693260 8:143971970-143971992 GAAGTAGTTCCCACCCCAGGAGG No data
1049693250_1049693260 23 Left 1049693250 8:143971924-143971946 CCCAGCAACCTCCAGGGATCTGT No data
Right 1049693260 8:143971970-143971992 GAAGTAGTTCCCACCCCAGGAGG No data
1049693253_1049693260 15 Left 1049693253 8:143971932-143971954 CCTCCAGGGATCTGTCTGGCTCA No data
Right 1049693260 8:143971970-143971992 GAAGTAGTTCCCACCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type