ID: 1049693261

View in Genome Browser
Species Human (GRCh38)
Location 8:143971976-143971998
Sequence GTTCCCACCCCAGGAGGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049693256_1049693261 -2 Left 1049693256 8:143971955-143971977 CCCCTGGATGAATCAGAAGTAGT No data
Right 1049693261 8:143971976-143971998 GTTCCCACCCCAGGAGGTAGAGG No data
1049693251_1049693261 28 Left 1049693251 8:143971925-143971947 CCAGCAACCTCCAGGGATCTGTC No data
Right 1049693261 8:143971976-143971998 GTTCCCACCCCAGGAGGTAGAGG No data
1049693253_1049693261 21 Left 1049693253 8:143971932-143971954 CCTCCAGGGATCTGTCTGGCTCA No data
Right 1049693261 8:143971976-143971998 GTTCCCACCCCAGGAGGTAGAGG No data
1049693250_1049693261 29 Left 1049693250 8:143971924-143971946 CCCAGCAACCTCCAGGGATCTGT No data
Right 1049693261 8:143971976-143971998 GTTCCCACCCCAGGAGGTAGAGG No data
1049693254_1049693261 18 Left 1049693254 8:143971935-143971957 CCAGGGATCTGTCTGGCTCACCC No data
Right 1049693261 8:143971976-143971998 GTTCCCACCCCAGGAGGTAGAGG No data
1049693258_1049693261 -4 Left 1049693258 8:143971957-143971979 CCTGGATGAATCAGAAGTAGTTC No data
Right 1049693261 8:143971976-143971998 GTTCCCACCCCAGGAGGTAGAGG No data
1049693257_1049693261 -3 Left 1049693257 8:143971956-143971978 CCCTGGATGAATCAGAAGTAGTT No data
Right 1049693261 8:143971976-143971998 GTTCCCACCCCAGGAGGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049693261 Original CRISPR GTTCCCACCCCAGGAGGTAG AGG Intronic