ID: 1049693263

View in Genome Browser
Species Human (GRCh38)
Location 8:143971980-143972002
Sequence CTTTCCTCTACCTCCTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049693263_1049693275 22 Left 1049693263 8:143971980-143972002 CCACCCCAGGAGGTAGAGGAAAG No data
Right 1049693275 8:143972025-143972047 CTCAGCACAATGCCCAGAACAGG No data
1049693263_1049693270 -6 Left 1049693263 8:143971980-143972002 CCACCCCAGGAGGTAGAGGAAAG No data
Right 1049693270 8:143971997-143972019 GGAAAGACAGCCCTGGGGCCAGG No data
1049693263_1049693278 28 Left 1049693263 8:143971980-143972002 CCACCCCAGGAGGTAGAGGAAAG No data
Right 1049693278 8:143972031-143972053 ACAATGCCCAGAACAGGCTGGGG No data
1049693263_1049693276 26 Left 1049693263 8:143971980-143972002 CCACCCCAGGAGGTAGAGGAAAG No data
Right 1049693276 8:143972029-143972051 GCACAATGCCCAGAACAGGCTGG No data
1049693263_1049693277 27 Left 1049693263 8:143971980-143972002 CCACCCCAGGAGGTAGAGGAAAG No data
Right 1049693277 8:143972030-143972052 CACAATGCCCAGAACAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049693263 Original CRISPR CTTTCCTCTACCTCCTGGGG TGG (reversed) Intronic