ID: 1049693264

View in Genome Browser
Species Human (GRCh38)
Location 8:143971983-143972005
Sequence TGTCTTTCCTCTACCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049693264_1049693275 19 Left 1049693264 8:143971983-143972005 CCCCAGGAGGTAGAGGAAAGACA No data
Right 1049693275 8:143972025-143972047 CTCAGCACAATGCCCAGAACAGG No data
1049693264_1049693277 24 Left 1049693264 8:143971983-143972005 CCCCAGGAGGTAGAGGAAAGACA No data
Right 1049693277 8:143972030-143972052 CACAATGCCCAGAACAGGCTGGG No data
1049693264_1049693270 -9 Left 1049693264 8:143971983-143972005 CCCCAGGAGGTAGAGGAAAGACA No data
Right 1049693270 8:143971997-143972019 GGAAAGACAGCCCTGGGGCCAGG No data
1049693264_1049693278 25 Left 1049693264 8:143971983-143972005 CCCCAGGAGGTAGAGGAAAGACA No data
Right 1049693278 8:143972031-143972053 ACAATGCCCAGAACAGGCTGGGG No data
1049693264_1049693276 23 Left 1049693264 8:143971983-143972005 CCCCAGGAGGTAGAGGAAAGACA No data
Right 1049693276 8:143972029-143972051 GCACAATGCCCAGAACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049693264 Original CRISPR TGTCTTTCCTCTACCTCCTG GGG (reversed) Intronic