ID: 1049693269

View in Genome Browser
Species Human (GRCh38)
Location 8:143971992-143972014
Sequence GTAGAGGAAAGACAGCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049693257_1049693269 13 Left 1049693257 8:143971956-143971978 CCCTGGATGAATCAGAAGTAGTT No data
Right 1049693269 8:143971992-143972014 GTAGAGGAAAGACAGCCCTGGGG No data
1049693258_1049693269 12 Left 1049693258 8:143971957-143971979 CCTGGATGAATCAGAAGTAGTTC No data
Right 1049693269 8:143971992-143972014 GTAGAGGAAAGACAGCCCTGGGG No data
1049693262_1049693269 -10 Left 1049693262 8:143971979-143972001 CCCACCCCAGGAGGTAGAGGAAA No data
Right 1049693269 8:143971992-143972014 GTAGAGGAAAGACAGCCCTGGGG No data
1049693256_1049693269 14 Left 1049693256 8:143971955-143971977 CCCCTGGATGAATCAGAAGTAGT No data
Right 1049693269 8:143971992-143972014 GTAGAGGAAAGACAGCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049693269 Original CRISPR GTAGAGGAAAGACAGCCCTG GGG Intronic